Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8537

Itch itchy, E3 ubiquitin protein ligase ( MGI:1202301)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537
"Pseudo-wholemount" of euxassay_009772. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009772_01 euxassay_009772_02 euxassay_009772_03 euxassay_009772_04
EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537
euxassay_009772_05 euxassay_009772_06 euxassay_009772_07 euxassay_009772_08 euxassay_009772_09
EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537
euxassay_009772_10 euxassay_009772_11 euxassay_009772_12 euxassay_009772_13 euxassay_009772_14
EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537
euxassay_009772_15 euxassay_009772_16 euxassay_009772_17 euxassay_009772_18 euxassay_009772_19
EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537 EMAGE:8537
euxassay_009772_20 euxassay_009772_21 euxassay_009772_22 euxassay_009772_23 euxassay_009772_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8537Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8537_wholemount_strong.wlz
8537_wholemount_moderate.wlz
8537_wholemount_weak.wlz
8537_wholemount_possible.wlz
8537_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8537_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 14 15 17 moderate expression: see section 10 16
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 12 17 18 20 21 22 23 24 moderate expression: see section 10 11 19
telencephalon marginal layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 12 13 14 15 16 17 18 20 21 22 23 24 moderate expression: see section 10 11 19
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 17
medulla oblongata basal plate marginal layer
strong strong
single cellstrong expression: see section 16
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 13
facial vii ganglion
strong strong
regionalstrong expression: see section 22 moderate expression: see section 04
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 18 19 20
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30618
Entity Detected:Itch, itchy, E3 ubiquitin protein ligase ( MGI:1202301)
Sequence:sense strand is shown

>T30618
TGAAACGTCATGCTCCGAGAGTACTACACAGAATGATGATGGCTGCAGAACCAGAGATGATACAAGAGTG
AGCACAAATGGATCAGAGGACCCTGAGGTTGCAGCGTCAGGGGAAAACAAGAGGGCCAATGGGAACAATT
CTCCGTCCCTTTCAAATGGTGGTTTTAAGCCTTCTAGACCTCCTAGACCTTCGAGACCACCTCCACCCAC
CCCACGAAGACCAGCTTCTGTCAATGGCTCACCATCCACGAATTCTGACAGTGATGGATCTAGTACAGGC
TCCTTGCCACCAACAAATACAAATGTAAATACAAGTACATCTGAAGGAGCAACATCTGGATTAATAATTC
CTCTTACTATATCTGGAGGCTCGGGCCCTAGGCCTCTGAATACTGTAAGCCAAGCTCCCCTACCACCTGG
GTGGGAGCAGAGAGTAGACCAGCATGGGCGTGTTTACTATGTAGACCATGTTGAAAAGCGAACAACATGG
GATAGACCAGAACCTCTACCTCCTGGCTGGGAACGGCGTGTGGACAATATGGGACGTATTTATTATGTTG
ATCATTTCACAAGAACCACAACATGGCAGAGGCCAACCTTGGAATCTGTCCGGAACTATGAACAGTGGCA
GCTACAGCGTAGTCAGCTTCAGGGAGCAATGCAGCAGTTTAACCAGAGATTCATCTATGGGAATCAAGAT
TTGTTTGCTACATCACAAAACAAAGAATTTGATCCGCTTGGTCCGTTGCCCCCTGGATGGGAGAAGAGAA
CTGATAGCAACGGCAGAGTGTATTTTGTCAACCACAACACTCGGATTACTCAGTGGGAAGACCCCAGAAG
CCAAGGTCAGTTAAATGAAAAGCCCTTACCAGAAGGCTGGGAAATGAGATTCACAGTGGATGGAATTCCA
TATTTTGTGGACCACAATAGAAGAGCAACTACTTATATAGATCCACGAACGGGAAAATCAGCCTTAGACA
ATGGGCCCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6409535), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59795. Forward Primer - name:059795_F_IRAV115_c02_Itch, sequence:TGAAACGTCATGCTCCGA; Reverse Primer - name:059795_R_SP6_IRAV115_c02_Itch, sequence:TCTGGGGCCCATTGTCTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8536 same embryo
 EMAGE:8538 same embryo
 EurExpress:euxassay_009772 same experiment
 MGI:4825634 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS