Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8666

Prdx6 peroxiredoxin 6 ( MGI:894320)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666
"Pseudo-wholemount" of euxassay_009929. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009929_01 euxassay_009929_02 euxassay_009929_03 euxassay_009929_04
EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666
euxassay_009929_05 euxassay_009929_06 euxassay_009929_07 euxassay_009929_08 euxassay_009929_09
EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666
euxassay_009929_10 euxassay_009929_11 euxassay_009929_12 euxassay_009929_13 euxassay_009929_14
EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666
euxassay_009929_15 euxassay_009929_16 euxassay_009929_17 euxassay_009929_18 euxassay_009929_19
EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666 EMAGE:8666
euxassay_009929_20 euxassay_009929_21 euxassay_009929_22 euxassay_009929_23 euxassay_009929_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8666Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8666_wholemount_strong.wlz
8666_wholemount_moderate.wlz
8666_wholemount_weak.wlz
8666_wholemount_possible.wlz
8666_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8666_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16 weak expression: see section 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 01 02 03 04
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 16
metencephalon floor plate
strong strong
regionalstrong expression: see section 12 13
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 05 06 07 11 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 17 18
spinal cord floor plate
strong strong
regionalstrong expression: see section 10 11 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 13 15 16 moderate expression: see section 09 10 11 17 18 19
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 17 18 19 22 weak expression: see section 16 20
maxilla
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 17 18 19 weak expression: see section 20
hepatic duct
moderate moderate
regionalmoderate expression: see section 10
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 04
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 16 17 18
left lung
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 08 09 10 weak expression: see section 04
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30954
Entity Detected:Prdx6, peroxiredoxin 6 ( MGI:894320)
Sequence:sense strand is shown

>T30954
AAATTGGGGCTGCATCTGCACATCCAGTACTGGGGCCTGAGGATGTCAGCTGGCAGCCGTGGGTCCTTGC
AGCAGGTCCGTAGAAAGATCGTGGCATGATCACAGCCGGTCCTGTAGATCGCTCGCTATACTACTGGGTC
ATTAAATGGAAATGGCACCAAAACCTTCTCGGGATTCTTTACTCTGTGCCTTCGCCAGCATTCTGCCCCT
CTGCCTGTCACAGTGCCCTACTGACTGGCTCTCTTTGAAACGAATTATGTATTGAAGATTCCTTAGGTCT
CTGTAGGGTCTTTGATCAGCAAACAAGGTAGTGTCAGTGTGGGCTCTGTGCTAGAATGATGAAACACCTT
TTGTATCTTTCCGAACTGAATCTTCTGTTACCCATTTTGGAGAGCACTGACATAGGGAGAAGCTTTCGAT
TCTGTATTTTTAGTAAATAAAAAGTGGGGACAGCCGGGAGAATTCTTACAGGGAATCTATTGTAAGTTTC
TATCGAAGTGGGCTCAGAAAGCCTTTCGCCTCCCAAGAGTGCGCATGTACCTCCTAGAGTTTCCACATCT
GCTCTCTGGTGATGTCTGCCTGTGAACGCACCTTATAAAAGACGGGCGGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4215591), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 19221. Forward Primer - name:019221_F_IRAV28-31_K13_Prdx6, sequence:AAATTGGGGCTGCATCTG; Reverse Primer - name:019221_R_SP6_IRAV28-31_K13_Prdx6, sequence:GTCACCGCCCGTCTTTTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8670 same embryo
 EMAGE:8667 same embryo
 EMAGE:8669 same embryo
 EMAGE:8665 same embryo
 EMAGE:8668 same embryo
 EurExpress:euxassay_009929 same experiment
 MGI:4827403 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS