Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8684

Nt5dc2 5'-nucleotidase domain containing 2 ( MGI:1917271)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684
"Pseudo-wholemount" of euxassay_009884. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009884_01 euxassay_009884_02 euxassay_009884_03 euxassay_009884_04
EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684
euxassay_009884_05 euxassay_009884_06 euxassay_009884_07 euxassay_009884_08 euxassay_009884_10
EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684
euxassay_009884_11 euxassay_009884_12 euxassay_009884_13 euxassay_009884_14 euxassay_009884_15
EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684 EMAGE:8684
euxassay_009884_16 euxassay_009884_17 euxassay_009884_18 euxassay_009884_19 euxassay_009884_20
EMAGE:8684 EMAGE:8684
euxassay_009884_21 euxassay_009884_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8684Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8684_wholemount_strong.wlz
8684_wholemount_moderate.wlz
8684_wholemount_weak.wlz
8684_wholemount_possible.wlz
8684_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8684_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 02 03 04 18 19 weak expression: see section 20
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 16 17 18
pancreas
weak weak
regionalweak expression: see section 06 07
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 14
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 13 14 16 17 18 weak expression: see section 06 07 08 09
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 08 09 10 11 12 14 15 16 17 18 19 20 weak expression: see section 04 05 06 07 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15
pons mantle layer
weak weak
regionalweak expression: see section 07 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 12 13 14 weak expression: see section 08 09 11
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20
maxilla
weak weak
regionalweak expression: see section 07 08 09 17 18 19
bladder
weak weak
regionalweak expression: see section 09 10 11 12
renal cortex
weak weak
regionalweak expression: see section 03 04 05 06 07 12 13 14 15
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20
vault of skull
moderate moderate
regionalmoderate expression: see section 01
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 weak expression: see section 07 08 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30945
Entity Detected:Nt5dc2, 5'-nucleotidase domain containing 2 ( MGI:1917271)
Sequence:sense strand is shown

>T30945
TCTCGCTCCCAGAGATGGCTCTGCTGTCCTGTGTGGTGGACTACTTTCTGGGCCACGGCCTGGAGTTTGA
CCAAGTACATCTCTACAAGGATGTGACGGATGCTATCCGCGATGTGCATGTAAAGGGCCTCATGTACCAG
TGGATCGAGCAAGACATGGAGAAGTACATCCTGAGAGGAGATGAGACATTTGCGGTGCTGAGCCGCCTGG
TGGCCCATGGGAAACAGCTGTTCCTCATTACCAACAGTCCCTTCAGCTTTGTGGACAAAGGTATGCGGCA
CATGGTAGGTCCCGATTGGCGCCAACTCTTCGACGTCGTCATCGTCCAGGCAGACAAGCCCAACTTTTTC
ACCGACAGGCGCAAGCCTTTTCGCAAGCTTGACGAGAAGGGCTCCCTCCACTGGGACCGTATCACTCGCC
TAGAGAAGGGCAAGATCTATCGGCAGGGAAACCTGTTTGATTTTCTTCGTCTGACGGAATGGCGAGGGCC
GCGTGTGCTCTACTTCGGTGACCACCTTTACAGTGACCTGGCGGATCTCATGCTGCGGCACGGCTGGCGC
ACGGGAGCCATCATCCCTGAGCTGGAGCGCGAGATCCGCATCATCAACACGGAGCAGTACATGCACTCGC
TGACCTGGCAGCAGGCTCTCACTGGGCTGCTGGAGCGCATGCAGACCTATCAGGATGCAGAGTCACGGCA
GGTGCTGGCTACCTGGATGAAGGAGCGGCAAGAACTGAGATGCATCACAAAGGCCCTATTCAACGCCCAG
TTCGGGAGCATCTTCCGCACCTTCCACAACCCTACCTACTTCTCCCGGCGCCTCGTGCGCTTCTCCGACC
TCTACATGGCCTCACTCAGCTGCCTGCTCAACTACCGCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4207917), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 19171. Forward Primer - name:019171_F_IRAV28-31_I19_2510015F01Rik, sequence:TCTCGCTCCCAGAGATGG; Reverse Primer - name:019171_R_SP6_IRAV28-31_I19_2510015F01Rik, sequence:ACGCGGTAGTTGAGCAGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8690 same embryo
 EMAGE:8686 same embryo
 EMAGE:8687 same embryo
 EMAGE:8688 same embryo
 EMAGE:8689 same embryo
 EMAGE:8683 same embryo
 EMAGE:8685 same embryo
 EurExpress:euxassay_009884 same experiment
 MGI:4826810 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS