Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8695

Mcpt4 mast cell protease 4 ( MGI:96940)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695
"Pseudo-wholemount" of euxassay_009917. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009917_01 euxassay_009917_02 euxassay_009917_03 euxassay_009917_04
EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695
euxassay_009917_05 euxassay_009917_06 euxassay_009917_07 euxassay_009917_08 euxassay_009917_09
EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695
euxassay_009917_10 euxassay_009917_11 euxassay_009917_12 euxassay_009917_13 euxassay_009917_14
EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695
euxassay_009917_15 euxassay_009917_16 euxassay_009917_17 euxassay_009917_18 euxassay_009917_19
EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695 EMAGE:8695
euxassay_009917_20 euxassay_009917_21 euxassay_009917_22 euxassay_009917_23 euxassay_009917_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8695Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8695_wholemount_strong.wlz
8695_wholemount_moderate.wlz
8695_wholemount_weak.wlz
8695_wholemount_possible.wlz
8695_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8695_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
lower jaw
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23 24
upper jaw
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 10 12 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31059
Entity Detected:Mcpt4, mast cell protease 4 ( MGI:96940)
Sequence:sense strand is shown

>T31059
CTCTTGCCTTCTGGGGCTGGAGCTGAGGAGATTATTGGTGGTGTTGAGTCTAGACCACATTCTCGCCCTT
ACATGGCCCATCTGGAGATCACCACTGAGAGAGGGTTCACAGCTACCTGTGGTGGGTTTCTCATAACCCG
CCAATTTGTGTTGACTGCTGCACACTGTAGTGGAAGAGAAATCACTGTCACCCTTGGAGCTCATGATGTG
AGCAAGACAGAATCCACACAGCAGAAGATAAAAGTAGAAAAACAAATCGTTCACCCAAAGTACAACTTCT
ATTCCAATCTCCATGACATCATGTTGCTGAAGCTTCAAAAGAAAGCCAAAGAGACTCCCTCTGTGAATGT
AATTCCTCTGCCTCGTCCTTCTGACTTTATCAAGCCGGGGAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1314753), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 56537. Forward Primer - name:056537_F_IRAV40_a03_Mcpt4, sequence:CTCTTGCCTTCTGGGGCT; Reverse Primer - name:056537_R_SP6_IRAV40_a03_Mcpt4, sequence:TCTTCCCCGGCTTGATAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8696 same embryo
 EMAGE:8694 same embryo
 EMAGE:8692 same embryo
 EMAGE:8693 same embryo
 EMAGE:8691 same embryo
 EurExpress:euxassay_009917 same experiment
 MGI:4826135 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS