Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8797

Pdxk pyridoxal (pyridoxine, vitamin B6) kinase ( MGI:1351869)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797
"Pseudo-wholemount" of euxassay_007254. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007254_01 euxassay_007254_02 euxassay_007254_03 euxassay_007254_04
EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797
euxassay_007254_05 euxassay_007254_06 euxassay_007254_07 euxassay_007254_08 euxassay_007254_09
EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797
euxassay_007254_10 euxassay_007254_11 euxassay_007254_12 euxassay_007254_13 euxassay_007254_14
EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797
euxassay_007254_15 euxassay_007254_16 euxassay_007254_17 euxassay_007254_18 euxassay_007254_19
EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797 EMAGE:8797
euxassay_007254_20 euxassay_007254_21 euxassay_007254_22 euxassay_007254_23 euxassay_007254_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8797Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8797_wholemount_strong.wlz
8797_wholemount_moderate.wlz
8797_wholemount_weak.wlz
8797_wholemount_possible.wlz
8797_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8797_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
pancreas
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 11 12
thyroid gland
moderate moderate
regionalmoderate expression: see section 11 12 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 20 21 22 weak expression: see section 05
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 17 18
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 24 weak expression: see section 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19 20
vomeronasal organ
strong strong
regionalstrong expression: see section 13 15
esophagus
moderate moderate
regionalmoderate expression: see section 13
hindgut
moderate moderate
regionalmoderate expression: see section 12
rectum
moderate moderate
regionalmoderate expression: see section 12
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 24 weak expression: see section 06 07 08 09 10 18 19 20 21 22 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16 weak expression: see section 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 20
maxilla
weak weak
regionalweak expression: see section 07 09 10 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16 weak expression: see section 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 20
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 24 moderate expression: see section 23
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18 19 20
urethra of male
weak weak
regionalweak expression: see section 11 12
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 04 05 06 07 22 weak expression: see section 02 03 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 11 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2009
Entity Detected:Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase ( MGI:1351869)
Sequence:sense strand is shown

>T2009
GCCTGAGCAACCCCAGCCTGTGACACCACCTGGACCACGCGCCACTACAGCTTTCCCGGCATGGAGGGCG
AATGCCGGGTGCTCTCCATCCAGAGCCATGTTGTCCGTGGCTACGTGGGTAACAGAGCGGCCATGTTCCC
TCTGCAGGTTTTGGGATTTGAGGTTGATGCCGTGAACTCTGTGCAGTTTTCAAACCACACAGGCTACGCC
CATTGGAAGGGCCAGGTGCTGAAGTCCCAGGAACTTCATGAGCTGTACGAGGGTCTCAAGGTGAACGATG
TCAATAAGTATGACTACGTGCTCACTGGTTACACGAGAGACAAGTCTTTCCTGGCCATGGTGGTGGACAT
TGTGCGGGAGCTGAAGCAACAGAACTCTCGCCTTGTGTATGTGTGTGACCCTGTGATGGGCGACAAGTGG
AATGGGGAAGGCTCCATGTACGTTACCCAGGACCTCCTCCCCGTGTACAGGGACAAAGTGGTACCCGTGG
CTGACATCATCACTCCCAACCAGTTTGAGGCTGAGTTGCTGAGTGG
Notes:The probe template was PCR amplified from IMAGE:734834 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:734834 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8796 same embryo
 EMAGE:8795 same embryo
 EMAGE:8793 same embryo
 EMAGE:8794 same embryo
 EurExpress:euxassay_007254 same experiment
 MGI:4827140 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS