Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8831

Olfr1395 olfactory receptor 1395 ( MGI:3031229)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831
"Pseudo-wholemount" of euxassay_012995. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012995_01 euxassay_012995_02 euxassay_012995_03 euxassay_012995_04
EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831
euxassay_012995_05 euxassay_012995_06 euxassay_012995_07 euxassay_012995_08 euxassay_012995_09
EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831
euxassay_012995_10 euxassay_012995_11 euxassay_012995_12 euxassay_012995_13 euxassay_012995_14
EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831
euxassay_012995_15 euxassay_012995_16 euxassay_012995_17 euxassay_012995_18 euxassay_012995_19
EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831 EMAGE:8831
euxassay_012995_20 euxassay_012995_21 euxassay_012995_22 euxassay_012995_23 euxassay_012995_24
EMAGE:8831 EMAGE:8831
euxassay_012995_25 euxassay_012995_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8831Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8831_wholemount_strong.wlz
8831_wholemount_moderate.wlz
8831_wholemount_possible.wlz
8831_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8831_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
spottedstrong expression: see section 10 11 12 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39105
Entity Detected:Olfr1395, olfactory receptor 1395 ( MGI:3031229)
Sequence:sense strand is shown

>T39105
CTCCACTGCATCTCTTCCTCTTCTCCATCATTATGGTCATGTTCCTGGTGGCCCTCTCTGGCAATGGGCT
CATGATCCTCCTCATCCTTATGGACTCTCGCCTGCACACCCCGATGTACTTCTTCCTCAGTTGGCTGTCC
CTCATGGACCTCATGCTCATCTCCACCATTGTGCCACGGATGGCTGCTGACTTTCTCCTGGGCCGTGGCT
CCATCTCCTTCGCTGGCTGTGGGCTCCAGATTCTCTTCTTCCTCACCCTCCTGGGGGATGAGTGCTTCCT
GCTAGCCTTCATGGCCTATGACCGCTATGTGGCCATTAGCAACCCGCTGAGATACTCTGTAATCATGAGC
CGCCGTGTCTGCTGGCTCATGGTAGCGGGGTCTTGGCTCTTTGGCCTGGTAGATGGGCTGATCCAGGCTG
TTTTTACACTTCGCTTCCCCTACTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152512. Forward Primer - name:152512_F_cDNA_Olfr1395, sequence:CTCCACTGCATCTCTTCCTCTT; Reverse Primer - name:152512_N_SP6_cDNA_Olfr1395, sequence:GCAGTAGGGGAAGCGAAGTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8834 same embryo
 EMAGE:8836 same embryo
 EMAGE:8833 same embryo
 EMAGE:8832 same embryo
 EMAGE:8835 same embryo
 EurExpress:euxassay_012995 same experiment
 MGI:4826892 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS