Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8895

Olfr429 olfactory receptor 429 ( MGI:3030263)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895
"Pseudo-wholemount" of euxassay_013043. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013043_01 euxassay_013043_02 euxassay_013043_03 euxassay_013043_04
EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895
euxassay_013043_05 euxassay_013043_06 euxassay_013043_07 euxassay_013043_08 euxassay_013043_09
EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895
euxassay_013043_10 euxassay_013043_11 euxassay_013043_12 euxassay_013043_13 euxassay_013043_14
EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895
euxassay_013043_15 euxassay_013043_16 euxassay_013043_17 euxassay_013043_18 euxassay_013043_19
EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895 EMAGE:8895
euxassay_013043_20 euxassay_013043_21 euxassay_013043_22 euxassay_013043_23 euxassay_013043_24
EMAGE:8895
euxassay_013043_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8895Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8895_wholemount_strong.wlz
8895_wholemount_moderate.wlz
8895_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8895_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 11 12 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39128
Entity Detected:Olfr429, olfactory receptor 429 ( MGI:3030263)
Sequence:sense strand is shown

>T39128
TTCTTGGTGGTCTACCTGGACTCTCGGCTCCACACGCCCATGTACAGATTTGTCAGCATCCTTTCCTTCT
TGGAGCTGGGCTACACAGCTGCCACCATTCCCAAGATGCTAGCGAACTTGCTGAGTGAGAAGAAGACGAT
TTCCTTTTCTGGATGTCTCCTACAGATCTACTTCTTTCACTCTCTTGGAGCTACTGAGTGCTACCTCCTG
ACAGCAATGGCATATGACAGGTACTTAGCCATTTGCAGGCCTCTCCACTATCCCACCCTAATGACCCAGT
CACTTTGTATCAAGATTGCCATTGGTTGCTGGTTGGGAGGCTTGGCTGGGCCAGTGGTGGAAATTTCCTT
GGTGTCTCGTCTCCCTTTTTGTGGCCCCAATCACATTCAGCACATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152417. Forward Primer - name:152417_F_cDNA_Olfr429, sequence:TTCTTGGTGGTCTACCTGGACT; Reverse Primer - name:152417_N_SP6_cDNA_Olfr429, sequence:AATGTGCTGAATGTGATTGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8894 same embryo
 EMAGE:8891 same embryo
 EMAGE:8893 same embryo
 EMAGE:8896 same embryo
 EMAGE:8892 same embryo
 EurExpress:euxassay_013043 same experiment
 MGI:4826917 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS