Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8989

Mn1 meningioma 1 ( MGI:1261813)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989
"Pseudo-wholemount" of euxassay_012879. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012879_01 euxassay_012879_02 euxassay_012879_03 euxassay_012879_04
EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989
euxassay_012879_05 euxassay_012879_06 euxassay_012879_07 euxassay_012879_08 euxassay_012879_09
EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989
euxassay_012879_10 euxassay_012879_11 euxassay_012879_12 euxassay_012879_13 euxassay_012879_14
EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989
euxassay_012879_15 euxassay_012879_16 euxassay_012879_17 euxassay_012879_18 euxassay_012879_19
EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989 EMAGE:8989
euxassay_012879_20 euxassay_012879_21 euxassay_012879_22 euxassay_012879_23 euxassay_012879_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8989Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8989_wholemount_strong.wlz
8989_wholemount_moderate.wlz
8989_wholemount_weak.wlz
8989_wholemount_possible.wlz
8989_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8989_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 metacarpal
moderate moderate
regionalmoderate expression: see section 05 06
forelimb digit 2 metacarpal
moderate moderate
regionalmoderate expression: see section 05 06
forelimb digit 3 metacarpal
moderate moderate
regionalmoderate expression: see section 05
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 05 06 07
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 05 07 08
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 08 09
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 09
tarsus
moderate moderate
regionalmoderate expression: see section 05 06
head mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04
vibrissa
weak weak
regionalweak expression: see section 04 05 19 20 21
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 07 18 19 20 21 22 23 24 moderate expression: see section 01 02 03 04 08 09 10 11 12 13 14 15 16 17
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 05 06 07 09 10 15 16 17 18 19 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 18 21 weak expression: see section 03 05 06 07 08 09 10 11 12 13 14 15 16 17 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 07 10 11 12 13 14 17 18 weak expression: see section 06 08 09 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17 18 19 weak expression: see section 09 10 11 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 12 15
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38653
Entity Detected:Mn1, meningioma 1 ( MGI:1261813)
Sequence:sense strand is shown

>T38653
GCATTCACTAAGCTTCCATTCCTCTCATTGGGAGCAGTCCCTCTGGTCCCTTCTGGGTTGTGAGTTGGAT
GCTGGTGTCATGGGCACCCTCTCCTTCACTGAGGCTACCGTTGCGCCCTCTGCCTTCTCTGTGGCCTTGT
GACCCTCAAAGGGCACAAGGGAGGGTCTGCCAGTTGTCTAAGGGACTTACTGGCCCTGTTCTCCCAGATG
GCAGCCAGGGTGCCTCAGTTCCACCTCGCATAGCATCCCTAAGTGAATCCATCCCTGGGAGGAGGGATTG
AGGCAGCCAAATTCAGGCTGAGACACTCTTCGGTCCTGCACAGATCCTAGAGGGGAGGAGAGTAAATTGA
GTGGCTTTGTGATGCCTGTTCCCGAGACTCACGTTCCCTTTGTGGGATGTCTCCTGCCCTTTGGATTTGG
TTTCATTCTGATTTACAAGCAGAGCCCTGCCCAGTGTGTCCCCCTGGGAGAGACGCTTCTGCCTAAGTGG
AGGGGAGCAGAGATTGCTGAGCTGATGTAGATAAATCTACAGCTTAGGGTGTGCTCTGTACCCCGCCAAC
CTATGTGGCCCACTATGGCTATGCTGTGGGGCCCTGCATCCCTGGGAGGGTCAGTCAGGCCAGAGCCAGT
TCAGTTTTTGTTGTTAGTGTGTCTCTTCAATTACTCCTTTCTGAGCCCCACCTGAACTCGACAGACACCC
TTCCCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 107877. Forward Primer - name:107877_F_cDNA_LOC433938, sequence:GCATTCACTAAGCTTCCATTCC; Reverse Primer - name:107877_N_SP6_cDNA_LOC433938, sequence:AAGGGAAGGGTGTCTGTCGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8990 same embryo
 EMAGE:8988 same embryo
 EMAGE:8987 same embryo
 EurExpress:euxassay_012879 same experiment
 MGI:4826417 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS