Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9066

Tcf7l2 transcription factor 7-like 2, T-cell specific, HMG-box ( MGI:1202879)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066
"Pseudo-wholemount" of euxassay_019472. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019472_01 euxassay_019472_02 euxassay_019472_03 euxassay_019472_04
EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066
euxassay_019472_05 euxassay_019472_06 euxassay_019472_07 euxassay_019472_08 euxassay_019472_09
EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066
euxassay_019472_10 euxassay_019472_11 euxassay_019472_12 euxassay_019472_13 euxassay_019472_14
EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066 EMAGE:9066
euxassay_019472_15 euxassay_019472_16 euxassay_019472_17 euxassay_019472_18 euxassay_019472_19
EMAGE:9066
euxassay_019472_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9066Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9066_wholemount_strong.wlz
9066_wholemount_moderate.wlz
9066_wholemount_weak.wlz
9066_wholemount_possible.wlz
9066_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9066_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 04 20
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 19 20
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05 19 moderate expression: see section 20
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 06 07 18 19 moderate expression: see section 20
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 07 19 moderate expression: see section 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 12 weak expression: see section 04 05 06 07 19 20
pancreas
weak weak
regionalweak expression: see section 09 10
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 19 moderate expression: see section 03 04 08 17 18 20
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 weak expression: see section 11
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 weak expression: see section 11
telencephalon mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 17 18 19 20
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 11 15 weak expression: see section 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 09 10 11 15 weak expression: see section 07 08 16 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 11 13 14 moderate expression: see section 10
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 14 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 05 06 07 08 10 11 12 14 15 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 13 weak expression: see section 07 08 10 12 14 15 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 weak expression: see section 15
stomach
weak weak
regionalweak expression: see section 04 05 06 07 08
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12
lower lip
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 07 08 16 17
upper lip
moderate moderate
regionalmoderate expression: see section 09 15 weak expression: see section 06 07 08 16 17
trachea
moderate moderate
regionalmoderate expression: see section 12 13
sternum
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55200
Entity Detected:Tcf7l2, transcription factor 7-like 2, T-cell specific, HMG-box ( MGI:1202879)
Sequence:sense strand is shown

>T55200
TCCTTACATTCCCACAACTCGCTGGCTGGAACGCAACCCCAGCCTCTGTCTCTGGTGACCAAGTCTTTAG
AATAGCTCCGCCTCCTCGTCCTCCATGCCCCTGCTTGATTGAAGTGTTTCCTTCTGGTTCTTGGTTCGCC
CTTCCCCGCTTGGAAAGCTTTTGTTTTGTACTCTTTAATTTTGTGCCGCCGTGGCTACATGAGTTAATGT
TTATGGAGTTCATTGGTCAATATTTGACCCATTCTTATTTCAATTTCTCCTTTTAAATATGTAGATGAGA
AAAACCTCATGATTCTACCAAAATTTTTATCAACAGCTGTTTAAAGTCTTTGTAGCGTTTAAAAAATATA
TTATATATACATAACTGTTATGTAGTTCGGATAGCTTAGTTTTAAAAGACTGATTTAAAAAACAAAAAGA
AAAAAAAGAGAGAGAAGCAATTTTGAAGCACCCTCCAGAAGGAGTTGGTTCTGTGTTATTTGTATTAAAT
ACGAGCTTGCGAACCAATCACTTTACACCTTGGTATTTAAACCACGAGGGCACAAGGAATGCAGTGCCGT
TTCTTTCTTTCTTTTTTTCTTTCTTTTTTTTTTTCCTCCCAGTGTGAAACAACTTTTACCTTGATGTTAC
TTGTTATTGTTTAAATGTACAGAAACAAAGGGTTAAAATGTGTTAATATACCTTGTTCCATGGTGTTGTT
CTTTTGGGGGGGAGGGGACAACACTCAACAATGAATGGAATCAACACTGTTGGACCAGTAGTATTTATTG
CTTTAGAGGTTGCTTGCTGTACCTGTATGTCCGTCCAATTTTAAATATGTTTTCCCTTTTTTTTGAAACT
GTGTAAAGTCCCCCCCAACCTTAGCGTAAGCATCTTATATATAACAACTCATTTGTACAAGGTTTTTAAG
TTTATATATAAAATGTGTATATATTTTTTTGTTTCCTTTTTTTTTTTTTTGGCGTACGTTCGTTCGTTCG
TTTGTTTGTTTCTGTATAAAACCCAGATGCCACCAAATGGACATTGACATTCGCATTAAGGATCAGTAGC
ATTAACAAAACTTGCTTTAAAAGCCATTCTGTAAAACAAGACTTGAACATTAGCGAGAGGGTCTGAGCAG
CCGTCTGAGCAGCCGTGGGAACTGCCCCGTTTCCCCCTTGACCTCCTAGTCAACTGCCCTGTGCTCTTAG
AACATGGAC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TCCTTACATTCCCACAACTCGC; Reverse Primer - name:unspecified, sequence:GTCCATGTTCTAAGAGCACAGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828638 same experiment
 EurExpress:euxassay_019472 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS