Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9156

Shh sonic hedgehog ( MGI:98297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156
"Pseudo-wholemount" of euxassay_017945. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_017945_01 euxassay_017945_02 euxassay_017945_03 euxassay_017945_04
EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156
euxassay_017945_05 euxassay_017945_06 euxassay_017945_07 euxassay_017945_08 euxassay_017945_09
EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156
euxassay_017945_10 euxassay_017945_11 euxassay_017945_12 euxassay_017945_13 euxassay_017945_14
EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156
euxassay_017945_15 euxassay_017945_16 euxassay_017945_17 euxassay_017945_18 euxassay_017945_19
EMAGE:9156 EMAGE:9156 EMAGE:9156 EMAGE:9156
euxassay_017945_20 euxassay_017945_21 euxassay_017945_22 euxassay_017945_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9156Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9156_wholemount_strong.wlz
9156_wholemount_moderate.wlz
9156_wholemount_weak.wlz
9156_wholemount_possible.wlz
9156_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9156_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
spottedstrong expression: see section 10 11 12 13 14 15 weak expression: see section 08 09 16
adrenal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 14 15 16
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 18 19 20
hypothalamus mantle layer
weak weak
single cellweak expression: see section 12 16 17
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 weak expression: see section 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 21 22 23 moderate expression: see section 04 09 10 11 12 15 16 17 18 weak expression: see section 03 07 08 19 20
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 13 14
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 14 15
metencephalon floor plate
strong strong
regionalstrong expression: see section 14 15
midbrain ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
spinal cord floor plate
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 weak expression: see section 07
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 23
esophagus
strong strong
regionalstrong expression: see section 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22
hindgut
strong strong
regionalstrong expression: see section 09 10
midgut
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 20
bladder
strong strong
regionalstrong expression: see section 09 10 11
metanephros
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 06 14 15
urethra of male
strong strong
regionalstrong expression: see section 09 10
lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
trachea
weak weak
regionalweak expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51007
Entity Detected:Shh, sonic hedgehog ( MGI:98297)
Sequence:sense strand is shown

>T51007
ATGCTGCTGCTGCTGGCCAGATGTTTTCTGGTGATCCTTGCTTCCTCGCTGCTGGTGTGCCCCGGGCTGG
CCTGTGGGCCCGGCAGGGGGTTTGGAAAGAGGCGGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCA
GTTTATTCCCAACGTAGCCGAGAAGACCCTAGGGGCCAGCGGCAGATATGAAGGGAAGATCACAAGAAAC
TCCGAACGATTTAAGGAACTCACCCCCAATTACAACCCCGACATCATATTTAAGGATGAGGAAAACACGG
GAGCAGACCGGCTGATGACTCAGAGGTGCAAAGACAAGTTAAATGCCTTGGCCATCTCTGTGATGAACCA
GTGGCCTGGAGTGAAGCTGCGAGTGACCGAGGGCTGGGATGAGGACGGCCATCATTCAGAGGAGTCTCTA
CACTATGAGGGTCGAGCAGTGGACATCACCACGTCCGACCGGGACCGCAGCAAGTACGGCATGCTGGCTC
GCCTGGCTGTGGAAGCAGGTTTCGACTGGGTCTACTATGAATCCAAAGCTCACATCCACTGTTCTGTGAA
AGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGGGATCCGCCACCGTGCACCTGGAGCAG
GGCGGCACCAAGCTGGTGAAGGACTTACGTCCCGGAGACCGCGTGCTGGCGGCTGACGACCAGGGCCGGC
TGCTGTACAGCGACTTCCTCACCTTCCTGGACCGCGACGAAGGCGCCAAGAAGGTCTTCTACGTGATCGA
GACGCTGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTCTTCGTGGCGCCGCACAACGAC
TCGGGGCCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9157 same embryo
 EMAGE:9154 same embryo
 EMAGE:9155 same embryo
 EurExpress:euxassay_017945 same experiment
 MGI:4828056 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS