Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:917

Pax1 paired box gene 1 ( MGI:97485)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:917
Fig 2A Dupe et al, 1999 [PMID:10529422] . Copyright: This image is from Development and is displayed with the permission of the Comapny of Biologists Ltd who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: F, forebrain; M, midbrain; R, rhombencephalon; O, otocyst; P1, P2 and P3, 1st, 2nd and 3rd branchial pouches; S, somite.
Expression Pattern Description
Spatial Annotation:
EMAGE:917Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
917_wholemount_strong_3D_1.wlz
917_wholemount_moderate_3D_1.wlz
917_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:917_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
1st branchial pouch endoderm
detected detected
2nd branchial pouch endoderm
detected detected
3rd branchial pouch endoderm
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1309770
Entity Detected:Pax1, paired box gene 1 ( MGI:97485)
Sequence:sense strand is shown

>MGI:1309770
CTGGCCGGCCCGCGCGCGATGGAGCAGACGTACGGCGAAGTGAACCAACTTGGTGGCGTGTTCGTCAACG
GCCGTCCCCTGCCCAATGCCATCCGCCTACGAATCGTGGAGCTAGCACAGCTGGGTATCCGACCCTGTGA
CATCAGTAGGCAACTGCGGGTCTCTCATGGCTGCGTGAGCAAAATCCTGGCGCGCTACAACGAGACCGGC
TCCATCCTGCCCGGGGCCATCGGGGGCAGCAAACCTCGAGTTACCACCCCCAATGTAGTGAAGCACATCC
GGGACTACAAACAGGGGGATCCTGGCATCTTTGCCT
nt 292 - nt 607 of NM_008780
Notes:The probe used in this study by Dupe et al, 1999 [PMID:10529422] is indicated as that used by Deutsch et al, 1988 [PMID:2453291] ie: a "Pax1 313bp HincII-SacI fragment".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Dupe et al, 1999 [PMID:10529422] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10529422] Dupe V, Ghyselinck NB, Wendling O, Chambon P, Mark M 1999 Key roles of retinoic acid receptors alpha and beta in the patterning of the caudal hindbrain, pharyngeal arches and otocyst in the mouse. Development (126):5051-9
 [ doi:10.1016/0092-8674(88)90577-6] [ PMID:2453291] Deutsch U, Dressler GR, Gruss P 1988 Pax 1, a member of a paired box homologous murine gene family, is expressed in segmented structures during development. Cell (53):617-25
Links:MGI:1346583 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI