Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9182

Foxb1 forkhead box B1 ( MGI:1927549)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182
"Pseudo-wholemount" of euxassay_019645. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019645_01 euxassay_019645_02 euxassay_019645_03 euxassay_019645_04
EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182
euxassay_019645_05 euxassay_019645_06 euxassay_019645_07 euxassay_019645_08 euxassay_019645_09
EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182
euxassay_019645_10 euxassay_019645_11 euxassay_019645_12 euxassay_019645_13 euxassay_019645_14
EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182 EMAGE:9182
euxassay_019645_15 euxassay_019645_16 euxassay_019645_17 euxassay_019645_18 euxassay_019645_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9182Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9182_wholemount_strong.wlz
9182_wholemount_moderate.wlz
9182_wholemount_weak.wlz
9182_wholemount_possible.wlz
9182_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9182_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 11 16 17 weak expression: see section 10
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 10
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 11 13 14 15 16 17 18 19 moderate expression: see section 12
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 12
pons mantle layer
strong strong
regionalstrong expression: see section 07 19 moderate expression: see section 11
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 08
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55048
Entity Detected:Foxb1, forkhead box B1 ( MGI:1927549)
Sequence:sense strand is shown

>T55048
ATCGCTAGGGAGTACAAGATGCCTGGGGGGCTGGCCTTCTCTGCCATGCAGCCGGTTCCGGCTGCCTATC
CTCTCCCTAACCAGTTAACTACCATGGGCAGCTCTCTGGGCACTGGATGGCCACATGTGTACGGTTCCGC
GGGTATGATCGACTCAGCCACCCCCATCTCCATGACTAGTGGCGACTACAGCGCCTATGGAGTGCCGCTG
AAGCCGCTGTGCCACGCCGCGGGCCAGACGTTGCCCGCCATCCCAGTGCCCATCAAGCCCACGCCGGCCG
CAGTGCCCGCGCTGCCAGCTCTGCCCGCACCCATCCCCACCCTGCTCTCGAACTCGCCGCCTTCGCTCAG
CCCCACCTCCTCGCAGACAGCCACCAGCCAAAGCAGCCCCGCCACCCCTAGCGAGACACTCACCAGCCCG
GCCTCCGCCTTGCACTCGGTGGCCGTGCACTGACCCAAGGAAGCTGGGGCTCCGTCTTGGTCCACACCAC
CCCTCTCAACACTTCCCTGCTCCGGGTCCAGCCCTCCGCGACCTAAAACCGCCACCCCGACTTGGCCAAT
CTACCTTCTTCAGTCCTCGGTCTTAGAAGAACTTTTGGTTTTGGAACCAGAAGACAAACCACAAACTTGC
CGGAAGGCGTGTGAAAGTTGTCTTCGGTCCCTCTAGGGCACCAGAGAAAACAGGGGCTAATCCAAGCCAA
GCGGTCCCTCCCGGGACCCTGAAATGCACTCCCATCCAACAGGCAGAACACCCTGACTCCCTCCTGCTCG
GAGAAAACAAGAACCAAAACCAAAACCAAAACCAAAACAAAACAAAACAAAACAAAACAAAACAAAACAA
CAAAACTACTCGTCTTCTGAGCTTGGAGAGGCATAGCTCTGGACTCTGCGCAATTTCAAGACCAGAGACA
CTGCCCGGGAGCAGAAGCCCGCCGAGGCTGCAGCCGCACTAAGAGGGCCGGATCTTCTTAGGTCCTGAAA
ATCTGTGGCCACAAGACCAACTCACTGATC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ATCGCTAGGGAGTACAAGATGCC; Reverse Primer - name:unspecified, sequence:GATCAGTGAGTTGGTCTTGTGGC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4824897 same experiment
 EurExpress:euxassay_019645 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS