Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9259

Igf2 insulin-like growth factor 2 ( MGI:96434)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259
"Pseudo-wholemount" of euxassay_007179. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007179_01 euxassay_007179_02 euxassay_007179_03 euxassay_007179_04
EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259
euxassay_007179_05 euxassay_007179_06 euxassay_007179_07 euxassay_007179_08 euxassay_007179_09
EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259
euxassay_007179_10 euxassay_007179_11 euxassay_007179_12 euxassay_007179_13 euxassay_007179_14
EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259
euxassay_007179_15 euxassay_007179_16 euxassay_007179_17 euxassay_007179_18 euxassay_007179_19
EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259 EMAGE:9259
euxassay_007179_20 euxassay_007179_21 euxassay_007179_22 euxassay_007179_23 euxassay_007179_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9259Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9259_wholemount_strong.wlz
9259_wholemount_moderate.wlz
9259_wholemount_weak.wlz
9259_wholemount_possible.wlz
9259_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9259_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
intraembryonic coelom
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
strong strong
regionalstrong expression: see section 01 02 03 04 18 19 20 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
alimentary system
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
brain
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
skin
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
cardiovascular system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
liver and biliary system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
reproductive system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
respiratory system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 not examined expression: see section 01
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50013
Entity Detected:Igf2, insulin-like growth factor 2 ( MGI:96434)
Sequence:sense strand is shown

>T50013
CCTCGTCACTTCTCCTACGGTGTCCCAGCGGCAGCACAGATTTTGGAAAAGTGTGTGTGCCCCAAACACG
CACTGGACACTGCGCGGCGGCCAGGACGTGGGCAGTGTTGCTCCCGTGTCCAGGAAAACGACTGGGCATT
GCCCCCAGTTTCCCCCAAATTTGGGCATTGTCCCCGGGTCTTCCAACGGACTGGGCGTTGCCCCGGTTCA
CTGGGGACTGCCCTTGGGGTCTCGCTCACCTTCAGCAGCGTCCACTTCAGCAGCTCCCACTTCATCCGCT
CTCCCGCCCTTCTCCTCCGATCCTCCTGCGCCACGGACCCGACCTTCGGCCTTGTGGTACCAATGGGGAT
CCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGCTTAC
GGCCCCGGAGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGCGGCT
TCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCG
CAGCTGCGACCTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCTACC
TCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGA
GACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGCTTGC
CAAAGAGCTCAAAGAGTTCAGAGAGGCCAAACG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCTCGTCACTTCTCCTACG; Reverse Primer - name:unspecified, sequence:CGTTTGGCCTCTCTGAACTC. The reverse primer contains a 5' extension containing an T7 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using T7 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9261 same embryo
 EMAGE:9260 same embryo
 EMAGE:9257 same embryo
 EMAGE:9258 same embryo
 EMAGE:9262 same embryo
 EurExpress:euxassay_007179 same experiment
 MGI:4825534 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS