Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9324

Efnb1 ephrin B1 ( MGI:102708)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324
"Pseudo-wholemount" of euxassay_018017. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018017_01 euxassay_018017_02 euxassay_018017_03 euxassay_018017_04
EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324
euxassay_018017_05 euxassay_018017_06 euxassay_018017_07 euxassay_018017_08 euxassay_018017_09
EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324
euxassay_018017_10 euxassay_018017_11 euxassay_018017_12 euxassay_018017_13 euxassay_018017_14
EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324
euxassay_018017_15 euxassay_018017_16 euxassay_018017_17 euxassay_018017_18 euxassay_018017_19
EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324 EMAGE:9324
euxassay_018017_20 euxassay_018017_21 euxassay_018017_22 euxassay_018017_23 euxassay_018017_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9324Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9324_wholemount_strong.wlz
9324_wholemount_moderate.wlz
9324_wholemount_weak.wlz
9324_wholemount_possible.wlz
9324_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9324_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 23 24 weak expression: see section 02
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 20
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 01 22 weak expression: see section 03 20
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01 21 22 weak expression: see section 02 03
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 01 20 21 22 weak expression: see section 02
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 02
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 04 18 19 weak expression: see section 03
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
adrenal cortex
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 07 08 09 16 18 19
vibrissa
strong strong
regionalstrong expression: see section 03 17 18 19 20 moderate expression: see section 01 04 05 06 21
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13
diencephalon internal capsule
moderate moderate
regionalmoderate expression: see section 11
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 07 08 09 13 14 15
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12
medulla oblongata sulcus limitans
moderate moderate
regionalmoderate expression: see section 09
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 15 16 17 18 19 weak expression: see section 11 14
pons ventricular layer
strong strong
regionalstrong expression: see section 09 13 17 18 moderate expression: see section 06 07 08 12 15 16 19 weak expression: see section 11 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 13 14 15 16 17 moderate expression: see section 07 08 11 12
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 17 weak expression: see section 10 15 16 18
stomach
weak weak
regionalweak expression: see section 17 18 19 20 21 22 23 24
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
palatal shelf
moderate moderate
regionalmoderate expression: see section 07 08 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
bladder
weak weak
regionalweak expression: see section 11 12 13 14
metanephros
strong strong
regionalstrong expression: see section 06 17 18 moderate expression: see section 05 07 08 09 16 19
male reproductive system
weak weak
regionalweak expression: see section 11 14
lung
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50378
Entity Detected:Efnb1, ephrin B1 ( MGI:102708)
Sequence:sense strand is shown

>T50378
AAATCGACGGGACTGATTTGCTCGGCAGGGCCGTACTAGCCTTTTAAGTATACTGAGAAGGGCCGGTGCT
AAAGTAGAAGCTGTCGTGGGACGCGCCGGCGCGGAGTCCCACTGTGGCCCGGAGGAACGGAGTCCGTGTT
AGGGGGACCCAGTCGGGAGCCTGGGGACCGAGCTCGCATTGTTGGGAGACAACCCGCCTCTTCTTCCCAG
AGGCGTCAATCCCAGGACGGTCGAGGCGTCGGGGCAGCCACTGAGCGCTCTTCAGGGAGACCCGATCGGG
GAGAGGACTTGCAGTCTCAAACAATCTGGGAGAGCCGAGCGGAATCCGGCGGGATCACTCGGGGGCGGCG
AGCCCCCGTCGCGCCTCGTGCGGCGGAGAGGCCAGGGAAGAAAGTCCTCGGAGGCCGCAGCCCATGCGCG
GGTTGGGGACGCCTGCCCAGTGAGTCCTCCTGGCCAGCCGGGCGAAGGAGAGCGACCCCGAGGCCAGCGG
GAGGGGAGTGCTTCAAGGCCGGCGGCTGCGGAGGATGGGCGCCTGAGTGGCTCCGAGCGCTGCGCGGCAC
GGGCAGGCGAGGCGAGCTTTGCTGAGGAGGCGCTAGGGGATCCTGAAGTGCATTCTGCCCCGGGGAAAAT
GGCCCGGCCTGGGCAGCGTTGGCTCAGCAAGTGGCTTGTGGCTATGGTCGTGCTGACGCTGTGCCGGCTT
GCCACGCCGTTGGCCAAGAACCTGGAGCCCGTGTCCTGGAGCTCTCTTAACCCTAAGTTCCTAAGTGGGA
AGGGCTTGGTGATCTACCCGAAGATTGGAGACAAGCTGGACATCATCTGCCCCCGAGCAGAAGCAGGGCG
GCCCTACGAGTACTACAAGCTGTACCTGGTGCGGCCAGAGCAGGCGGCTGCTTGCAGCACTGTGCTTGAT
CCCAATGTACTGGTCACTTGCAACAAGCCACACCAGGAAAT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AAATCGAGGGACTGATTTG; Reverse Primer - name:unspecified, sequence:ATTTCCTGGTGTGGCTTGT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9323 same embryo
 EMAGE:9322 same embryo
 EurExpress:euxassay_018017 same experiment
 MGI:4824486 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS