Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9459

Arx aristaless related homeobox ( MGI:1097716)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459
"Pseudo-wholemount" of euxassay_018148. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018148_01 euxassay_018148_02 euxassay_018148_03 euxassay_018148_04
EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459
euxassay_018148_05 euxassay_018148_06 euxassay_018148_07 euxassay_018148_08 euxassay_018148_09
EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459
euxassay_018148_10 euxassay_018148_11 euxassay_018148_12 euxassay_018148_13 euxassay_018148_14
EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459
euxassay_018148_15 euxassay_018148_16 euxassay_018148_17 euxassay_018148_18 euxassay_018148_19
EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459 EMAGE:9459
euxassay_018148_20 euxassay_018148_21 euxassay_018148_22 euxassay_018148_23 euxassay_018148_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9459Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9459_wholemount_strong.wlz
9459_wholemount_moderate.wlz
9459_wholemount_weak.wlz
9459_wholemount_possible.wlz
9459_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9459_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
tarsus
weak weak
regionalweak expression: see section 01 02 03 18 19
pancreas
strong strong
spottedstrong expression: see section 07 08 11 12 13 14
diencephalon floor plate
strong strong
regionalstrong expression: see section 15
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19 20 21
cerebral cortex mantle layer
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 14
telencephalon mantle layer
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 14
olfactory cortex mantle layer
strong strong
spottedstrong expression: see section 09 11 15 16 moderate expression: see section 14
olfactory cortex ventricular layer
strong strong
spottedstrong expression: see section 10
telencephalon ventricular layer
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 15
metencephalon floor plate
strong strong
regionalstrong expression: see section 15
midbrain floor plate
strong strong
regionalstrong expression: see section 15
spinal cord floor plate
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
heart ventricle
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 13 14 15 17
tongue muscle
weak weak
regionalweak expression: see section 10 11 12 13 14 15
ovary
weak weak
regionalweak expression: see section 02 03 04 17 18 19
paramesonephric duct of female, rest of
moderate moderate
regionalmoderate expression: see section 01 02 18 19
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50123
Entity Detected:Arx, aristaless related homeobox ( MGI:1097716)
Sequence:sense strand is shown

>T50123
CTCAGCACCACTCAAGACCAAATGGAAACAGAGGACCAGCTCACTCCCAAGAAGGCACAGACAGAGCGCA
GCCGCCTTCGCAGCAGCTTGGAAGCGGACAAGGCAGTTCTTGGCGCTAAAGGATGTGGCACCTCCTCCAC
TGGCTGTCCACCTGCCCTTGTCCCTGTCCCTGTCCCTACCCCTGCCACTGCCAATGTCACTCCAACTCAA
AGTCCACTCTCCCGTTTTTACCTTACTGAAAATAACCCGGGAGGGGTTCTCCCCAATATGCTTAGTATTG
AAGTTTAAAAATTAAAAGCCCAACCTTCTCTTCCTCCGGATACCCCACTTAGCTTTTCTTTTGAATAGCA
TTTTGGCGCTCTATGTTGATTTAAGCGCGGCCCGGCTAAACAGATGCCAGGGCCAGGGAAGCGAATGCGA
ATCTGTAAGATAGCTAACAGTGCACTTAAAGGAAAGGGGCGTCTCGTTCTTGTTCTCTTCTTTATCATAC
ATCAACCAAGGTTTTTATATCAAACCAAAGGGAAATACTCTGCTAGAATATGGACTGTTGAAGTCACCAA
ACTGTGATTATTGATTCTGTACATACCATTGTTATTAAAAAAAAAAAGAACAGAGCTTTGTATATTTGAA
ATGTTATAACGCAATTGCACTCAGCGTGGTATGGTAAAAGTTTGTCCTCCTGTAGATTCTTACTGTGTTG
TAGATACGGTAGGGTTCCTAGACAAATATTTATGTACTCAAGCCCTTTATTTAACTTATTAACTGTAGAG
GCTTCGGAAACCTTCAAGATAAAGGCAATGGTACAGTACTTTTGTGTAATGTGTAATTGTTATCACTTTT
CCTTGCTATCTAGTGGAGAAGTGTCACGCTCA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CTCAGCACCACTCAAGACCA; Reverse Primer - name:unspecified, sequence:TGAGCGTGACACTTCTCCAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9460 same embryo
 EMAGE:9461 same embryo
 EurExpress:euxassay_018148 same experiment
 MGI:4823266 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS