Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9537

Erg avian erythroblastosis virus E-26 (v-ets) oncogene related ( MGI:95415)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537
"Pseudo-wholemount" of euxassay_019466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019466_01 euxassay_019466_02 euxassay_019466_03 euxassay_019466_04
EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537
euxassay_019466_05 euxassay_019466_06 euxassay_019466_07 euxassay_019466_08 euxassay_019466_09
EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537
euxassay_019466_10 euxassay_019466_11 euxassay_019466_12 euxassay_019466_13 euxassay_019466_14
EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537 EMAGE:9537
euxassay_019466_15 euxassay_019466_16 euxassay_019466_17 euxassay_019466_18 euxassay_019466_19
EMAGE:9537 EMAGE:9537 EMAGE:9537
euxassay_019466_20 euxassay_019466_21 euxassay_019466_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9537Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9537_wholemount_strong.wlz
9537_wholemount_moderate.wlz
9537_wholemount_weak.wlz
9537_wholemount_possible.wlz
9537_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9537_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
spottedstrong expression: see section 08 09 11 12 13 14 15 16 17 18 moderate expression: see section 10
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 05 06
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 04 05 06
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 06
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 07 08 22
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 06 09
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 07 08 09 22
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 09
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 07 08 09 21 22
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 06 09
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 08 09 20 21 22
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 06 09
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 07 08 09 20 21 22
not examined not examined
regionalnot examined expression: see section 05 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 weak expression: see section 13
trigeminal v nerve
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 05 06
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 16 weak expression: see section 06 15
nasal septum
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
viscerocranium
strong strong
regionalExpression in the turbinate bone.
stomach
weak weak
regionalweak expression: see section 18 19 20 21 22
hindgut
weak weak
regionalweak expression: see section 13 14 15
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 15 16 17 18
urethra of male
strong strong
regionalstrong expression: see section 12 13 14 15
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 10 12
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 12 13
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
trachea
strong strong
regionalstrong expression: see section 10 11
axial skeleton
strong strong
regionalstrong expression: see section 08 moderate expression: see section 05 06 12 13 14 weak expression: see section 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 19
temporal bone
moderate moderate
regionalmoderate expression: see section 02 03 04 19 20 21
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55044
Entity Detected:Erg, avian erythroblastosis virus E-26 (v-ets) oncogene related ( MGI:95415)
Sequence:sense strand is shown

>T55044
GATGTGGACGTCTTACTATTTCAGAATATCGATGGGAAGGAGCTGTGCAAGATGACAAAGGATGACTTCC
AGCGGCTCACGCCGAGCTACAATGCCGACATTCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCCCT
TCCACATCTGACTTCCGATGACGTTGATAAGGCTTTACAAAACTCTCCACGGTTAATGCATGCCAGAAAC
ACAGGGGGTGCAGCTTTTATTTTCCCAAATACTTCAGTATATCCCGAAGCTACGCAAAGAATTACAACTA
GGCCAGATTTACCTTATGAGCCTCCCAGGAGATCAGCCTGGACCGGCCACAGCCACCTCACCCCTCAGTC
CAAAGCTGCTCAGCCATCTCCCTCTGCAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTAC
CAGATCCTGGGACCGACCAGTAGCCGCCTTGCTAATCCAGGTAGTGGCCAGATCCAGCTGTGGCAGTTCC
TGCTCGAACTCCTGTCAGACAGCTCCAACTCCAACTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAA
GATGACAGACCCGGACGAGGTGGCTCGGCGCTGGGGGGAGAGGAAGAGCAAGCCCAACATGAACTATGAC
AAGCTCAGCCGCGCCCTCCGCTACTACTACGACAAAAACATCATGACCAAGGTGCACGGGAAGCGCTACG
CCTACAAGTTTGACTTCCACGGGATTGCCCAGGCCCTGCAGCCCCACCCTCCTGAGTCGTCCCTGTACAA
GTACCCCTCCGACCTGCCATACATGGGCTCCTATCACGCCCACCCCCAGAAGATGAACTTTGTGTCTCCC
CACCCTCCCGCTCTCCCAGTCACATCTTCCAGTTTCTTTGCTTCCCCGAACCCATACTGGAATTCACCGA
CTGGGGGCATCTACCCGAACACTAGGCTCCCA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GATGTGGACGTCTTACTATTT; Reverse Primer - name:unspecified, sequence:TGGGAGCCTAGTGTTCGGGTA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4824611 same experiment
 EurExpress:euxassay_019466 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS