Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9805

Pitx2 paired-like homeodomain transcription factor 2 ( MGI:109340)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805
"Pseudo-wholemount" of euxassay_019470. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019470_01 euxassay_019470_02 euxassay_019470_03 euxassay_019470_04
EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805
euxassay_019470_05 euxassay_019470_06 euxassay_019470_07 euxassay_019470_08 euxassay_019470_09
EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805
euxassay_019470_10 euxassay_019470_11 euxassay_019470_12 euxassay_019470_13 euxassay_019470_14
EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805
euxassay_019470_15 euxassay_019470_16 euxassay_019470_17 euxassay_019470_18 euxassay_019470_19
EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805 EMAGE:9805
euxassay_019470_20 euxassay_019470_21 euxassay_019470_22 euxassay_019470_23 euxassay_019470_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9805Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9805_wholemount_strong.wlz
9805_wholemount_moderate.wlz
9805_wholemount_weak.wlz
9805_wholemount_possible.wlz
9805_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9805_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
weak weak
regionalweak expression: see section 11 12 24
anterior abdominal wall muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 23 24 weak expression: see section 08 13 16 17 18 19 20 21 22
pectoralis major
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 08 09 10 12 13 14 16 17 18 20
pectoralis minor
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 08 09 10 12 13 14 16 17 18 20
pituitary gland
strong strong
regionalstrong expression: see section 11 12 13 14 15 17 18 moderate expression: see section 16
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 06
extrinsic ocular muscle
weak weak
regionalweak expression: see section 05 06 07 08 23 24
perioptic mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 06 07
tongue muscle
weak weak
regionalweak expression: see section 14 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 18 19 20
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 10 22 23 24
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 18 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 23 24
tail mesenchyme
weak weak
regionalweak expression: see section 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55145
Entity Detected:Pitx2, paired-like homeodomain transcription factor 2 ( MGI:109340)
Sequence:sense strand is shown

>T55145
CGTGGAAGTCGGCTCCCTAAAGAGGCTCGCAGCGGTTCCCTCCTGCCCACGTCCCCACGTCTGCGTTGGC
CCCCCTGCCTTTCGGCTGCCGAACTCTTTTTGGCTGGAGTCTGAAGCTAGAGGAGACAGGGCTGGAGGAT
TCGGCAGTTTGCGTTCCCTGGCTCTTTCAAGTCTCGGCTAACACGGGGACACTTGGCGCCTAGAGCGCTA
CCGAGAACCGGCGGCCACCGGGGCTCCACTGGCGGTAGCCCTGGACTCATAGGGCTCCGCACTCCCTCGT
CCATGAACTGCATGAAAGGCCCGCTGCCCTTGGAGCACCGAGCAGCCGGGACTAAGCTGTCGGCCGCCTC
CTCACCCTTCTGTCACCATCCCCAGGCGTTAGCCATGGCTTCGGTCCTAGCTCCTGGCCAGCCCCGCTCC
TTGGACTCCTCCAAACATAGACTGGAGGTGCATACAATCTCCGATACTTCCAGCCCTGAAGTCGCAGAGA
AAGATAAGGGCCAGCAAGGAAAGAATGAGGATGTGGGCGCCGAGGACCCGTCCAAGAAGAAGCGGCAACG
CCGGCAGAGGACTCATTTCACTAGCCAGCAGCTGCAGGAGCTGGAAGCCACTTTCCAGAGAAACCGC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9804 same embryo
 EurExpress:euxassay_019470 same experiment
 MGI:4827225 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS