Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9811

BC027231 cDNA sequence BC027231 ( MGI:2384836)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811
"Pseudo-wholemount" of euxassay_000110. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000110_01 euxassay_000110_02 euxassay_000110_03 euxassay_000110_04
EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811
euxassay_000110_05 euxassay_000110_06 euxassay_000110_07 euxassay_000110_08 euxassay_000110_09
EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811
euxassay_000110_10 euxassay_000110_11 euxassay_000110_12 euxassay_000110_13 euxassay_000110_14
EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811
euxassay_000110_15 euxassay_000110_16 euxassay_000110_17 euxassay_000110_18 euxassay_000110_19
EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811 EMAGE:9811
euxassay_000110_20 euxassay_000110_21 euxassay_000110_22 euxassay_000110_23 euxassay_000110_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9811Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9811_wholemount_strong.wlz
9811_wholemount_moderate.wlz
9811_wholemount_weak.wlz
9811_wholemount_possible.wlz
9811_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9811_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 13 14 15 16 17 18
sublingual gland primordium
strong strong
homogeneousstrong expression: see section 09 10 11 moderate expression: see section 13
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 21 22 moderate expression: see section 20 23 08 09 10 11 21 22
gut
moderate moderate
regionalmoderate expression: see section 09 11
pancreas
weak weak
regionalweak expression: see section 11 12 13
brain
strong strong
regionalstrong expression: see section 06 10 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon
strong strong
regionalstrong expression: see section 08 09 19 moderate expression: see section 12
pituitary gland
weak weak
regionalweak expression: see section 15
not examined not examined
othernot examined expression: see section 10
physiological umbilical hernia
strong strong
regionalstrong expression: see section 10 moderate expression: see section 16 weak expression: see section 14 15
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 09 weak expression: see section 08 05 06 07 09 10 23 24
3rd ventricle
strong strong
gradedstrong expression: see section 14
3rd ventricle choroid plexus
strong strong
gradedstrong expression: see section 14
diencephalon floor plate
strong strong
homogeneousstrong expression: see section 14
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 19
telencephalon
moderate moderate
regionalmoderate expression: see section 16
cerebral cortex
strong strong
homogeneousstrong expression: see section 17
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 16 17 18 19 20 21 22 23 24 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
corpus striatum
moderate moderate
regionalmoderate expression: see section 05 07 08 not detected expression: see section 20
telencephalon marginal layer
strong strong
homogeneousstrong expression: see section 12
olfactory lobe
strong strong
homogeneousstrong expression: see section 11 12 moderate expression: see section 14
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 11 12 13 18 19 20 21 moderate expression: see section 12 13 14 16 17 18 19 20
hindbrain
strong strong
regionalstrong expression: see section 08 09 11 12 moderate expression: see section 06 07
medulla oblongata floor plate
strong strong
homogeneousstrong expression: see section 14
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 15 16 17 18 moderate expression: see section 19
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 20 moderate expression: see section 19
metencephalon basal plate
strong strong
regionalstrong expression: see section 15 16 17 18 moderate expression: see section 19
pons
strong strong
gradedstrong expression: see section 20
pons mantle layer
strong strong
homogeneousstrong expression: see section 20 moderate expression: see section 19
midbrain
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 16 20 moderate expression: see section 06 07
midbrain floor plate
strong strong
regionalstrong expression: see section 11 14
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 11 12 20 21 not examined expression: see section 13
midbrain marginal layer
strong strong
homogeneousstrong expression: see section 10 11 12 16 17 18 not examined expression: see section 13
tegmentum
strong strong
regionalstrong expression: see section 11 15 16 moderate expression: see section 10 not examined expression: see section 13
facial vii ganglion
strong strong
homogeneousstrong expression: see section 09 10 20 21 22 moderate expression: see section 05
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 08 09 10 13 20 21 22 moderate expression: see section 08 09 21 22
inferior glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 20 21 22 23 24 moderate expression: see section 03 04 05 06 07 08 09 10 11 19 20 21 22 23 24
vagus x ganglion
strong strong
homogeneousstrong expression: see section 06 08 09 10 11 12 13 20 21 22 moderate expression: see section 10 19 20
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 20 21 22 moderate expression: see section 03 08 09 10 20 21 22
vestibulocochlear viii ganglion vestibular component
moderate moderate
regionalmoderate expression: see section 03
spinal cord
strong strong
regionalstrong expression: see section 11 12 13 16 17 18 moderate expression: see section 10 11 12 13 14 15 16 17 18 19 20
not examined not examined
othernot examined expression: see section 10
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 19 20
cervical ganglion
moderate moderate
regionalmoderate expression: see section 11 20
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 16
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15 19 20 21
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 06
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 05
optic nerve
strong strong
homogeneousstrong expression: see section 01
retina
strong strong
homogeneousstrong expression: see section 01
neural retina
strong strong
homogeneousstrong expression: see section 02 03 04 05
retina nerve fiber layer
strong strong
homogeneousstrong expression: see section 01 02 03 04
retina nuclear layer
strong strong
homogeneousstrong expression: see section 02
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08
stomach fundus epithelium
moderate moderate
regionalmoderate expression: see section 08
stomach fundus mucosa
moderate moderate
regionalmoderate expression: see section 07 08
lower jaw incisor
strong strong
regionalstrong expression: see section 13 weak expression: see section 13 14 18 19
lower jaw molar
weak weak
regionalweak expression: see section 09 10 11 21 22 23
upper jaw incisor
strong strong
regionalstrong expression: see section 13 weak expression: see section 13 15 18 19
upper jaw molar
weak weak
regionalweak expression: see section 09 10 11 21 22 23
metanephros
strong strong
regionalstrong expression: see section 11 13 moderate expression: see section 09 weak expression: see section 22
metanephros
moderate moderate
regionalmoderate expression: see section 12
kidney calyx
strong strong
regionalstrong expression: see section 11 13
kidney pelvis
moderate moderate
regionalmoderate expression: see section 12
collecting duct
strong strong
regionalstrong expression: see section 10 moderate expression: see section 12
medullary renal tubule
weak weak
regionalweak expression: see section 09 10 11 12 13 14 20 21 22 23 24
reproductive system
moderate moderate
regionalmoderate expression: see section 08
testis
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 07 08 09 10 24
testis
strong strong
regionalstrong expression: see section 08 09 10
tail dorsal root ganglion
strong strong
regionalstrong expression: see section 11 12 13 14 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1514
Entity Detected:BC027231, cDNA sequence BC027231 ( MGI:2384836)
Sequence:sense strand is shown

>T1514
TCCCACATGGTGAGTGTTTGGCTTAGACTGTGCAAGGTGTTAACTATGATGAACAGTCTGAGGAACACGT
CCTTCATGACTGAAACAAGTCAGTTTCTGAATTAGATGATTTTATGATCTACTGTTGAGTTAAAATCTGA
GTAATTTCATAAAATCTTACATATCTGAAGGTAAACAGAACAAGGCTGGAGTAGCAAAGCACCATAAAGG
GTCACCTGGCCTCACTGACCTCACTCCCTTTTAAAGTTTTATATTTTGTGCGAGGGTGTGTACGTATATG
TGGATATCAGAGGGTAACTTACATGAATGTGAATATCAGTGGGTAACCTGTGAGAGTTGGTTCTGTCCAC
CTATGGGTTCCAGGAGTGGTGTCTTAGTTAGGGTTTTACTGCTGTGAACAAACACCATGACAAGGCAACT
CTTATAAGGACACCATTTAATTGGGGCTGCCTTACAGGTTCAGAGGTTCAGTCCATTATCGTCAAGGTAG
GAGGAGCACGGCAGCA
Notes:The probe template was PCR amplified from IMAGE:761247 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:761247 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9812 same embryo
 EMAGE:9813 same embryo
 EMAGE:9814 same embryo
 EurExpress:euxassay_000110 same experiment
 MGI:4823419 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS