Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9812

Dnajb5 DnaJ (Hsp40) homolog, subfamily B, member 5 ( MGI:1930018)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812
"Pseudo-wholemount" of euxassay_000077. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000077_01 euxassay_000077_02 euxassay_000077_03 euxassay_000077_04
EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812
euxassay_000077_05 euxassay_000077_06 euxassay_000077_07 euxassay_000077_08 euxassay_000077_09
EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812
euxassay_000077_10 euxassay_000077_11 euxassay_000077_12 euxassay_000077_13 euxassay_000077_14
EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812
euxassay_000077_15 euxassay_000077_16 euxassay_000077_17 euxassay_000077_18 euxassay_000077_19
EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812 EMAGE:9812
euxassay_000077_20 euxassay_000077_21 euxassay_000077_22 euxassay_000077_23 euxassay_000077_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9812Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9812_wholemount_strong.wlz
9812_wholemount_moderate.wlz
9812_wholemount_weak.wlz
9812_wholemount_possible.wlz
9812_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9812_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall musculature
moderate moderate
spottedmoderate expression: see section 05 09 13 weak expression: see section 02 03 10
pelvic girdle musculature
moderate moderate
spottedmoderate expression: see section 05 09 11 12 weak expression: see section 10
central nervous system
strong strong
regionalstrong expression: see section 01 14
brain
strong strong
homogeneousstrong expression: see section 12
forebrain
strong strong
regionalstrong expression: see section 11
diencephalon
strong strong
regionalstrong expression: see section 14 15
vibrissa
weak weak
regionalweak expression: see section 09
hypothalamus
strong strong
regionalstrong expression: see section 15
thalamus
strong strong
regionalstrong expression: see section 14 15 16
telencephalon
strong strong
regionalstrong expression: see section 01 07 09 10 12 13 14
cerebral cortex
strong strong
regionalstrong expression: see section 01 02 04 05 06 07 08 10 11 12 13 16 18 20 23 moderate expression: see section 03
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 06 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
hindbrain
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metencephalon alar plate
strong strong
regionalstrong expression: see section 08 23
cerebellum
strong strong
regionalstrong expression: see section 05 06 07 23 24
metencephalon rest of alar plate
strong strong
regionalstrong expression: see section 06 07 23 24
metencephalon basal plate
strong strong
regionalstrong expression: see section 08
midbrain
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain lateral wall
strong strong
regionalstrong expression: see section 07 08
midbrain marginal layer
strong strong
regionalstrong expression: see section 06
central nervous system ganglion
strong strong
homogeneousstrong expression: see section 09 11 13
cranial ganglion
strong strong
regionalstrong expression: see section 09 10
facial vii ganglion
strong strong
regionalstrong expression: see section 08 09 10 16 19 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 10 13 19 20 21 22
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 12 14 19 20 21 22 24 weak expression: see section 04
vagus x ganglion
strong strong
regionalstrong expression: see section 08 09 10 12 14 15 19 20 21 22 moderate expression: see section 07 16 weak expression: see section 01
inferior vagus x ganglion
strong strong
regionalstrong expression: see section 08
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 09 10 20 21 22
central nervous system nerve
strong strong
homogeneousstrong expression: see section 11
accessory xi nerve
strong strong
regionalstrong expression: see section 09 12
facial vii nerve
strong strong
regionalstrong expression: see section 09 12 weak expression: see section 16
glossopharyngeal ix nerve
strong strong
regionalstrong expression: see section 13 14 15 16 17 20
hypoglossal xii nerve
strong strong
regionalstrong expression: see section 13 14 15 17 18 19 moderate expression: see section 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 12 13 15 20 23
trigeminal v nerve maxillary division
strong strong
homogeneousstrong expression: see section 20
vestibulocochlear viii nerve
strong strong
regionalstrong expression: see section 09
spinal cord
strong strong
homogeneousstrong expression: see section 15 16 17 18 19
autonomic nerve plexus
strong strong
regionalstrong expression: see section 14
hypogastric plexus
strong strong
regionalstrong expression: see section 17 18 19 moderate expression: see section 12 weak expression: see section 10
parasympathetic nervous system
strong strong
regionalstrong expression: see section 06 moderate expression: see section 05 08 weak expression: see section 02 04 09
parasympathetic nerve
weak weak
single cellweak expression: see section 02
vagal x nerve trunk
weak weak
regionalweak expression: see section 04 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08
peripheral nerve trunk
strong strong
regionalstrong expression: see section 17
spinal ganglion
strong strong
homogeneousstrong expression: see section 14
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 11 13 14 15 19 20 21 moderate expression: see section 12
brachial plexus
weak weak
regionalweak expression: see section 23 24
lumbosacral plexus
strong strong
regionalstrong expression: see section 13 17 19 20 21 22 moderate expression: see section 12 weak expression: see section 23 24
retina
strong strong
regionalstrong expression: see section 05 06
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 16
heart
weak weak
single cellweak expression: see section 11 12 16 19 20
tongue
weak weak
spottedweak expression: see section 16 18 19
tongue muscle
strong strong
regionalstrong expression: see section 13 weak expression: see section 19
tongue intrinsic muscle
strong strong
regionalstrong expression: see section 13
metanephros
weak weak
spottedweak expression: see section 10 13 20
lung
weak weak
spottedweak expression: see section 12 13 20 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1512
Entity Detected:Dnajb5, DnaJ (Hsp40) homolog, subfamily B, member 5 ( MGI:1930018)
Sequence:sense strand is shown

>T1512
TCCCCAGGGGTCAATTTTCTGTCACGTGCTTTGAATCCAGTTCCCACTGCAGTGGCTGGAGAGAGACTTG
AGAGCTACTCGGAGCTATAGATTCCTTGTCCTGCCTGTAAATAGCATGCCCTCCTCCCTCTGAGCCTTGC
TAACACTTTTCCTCTCCCTTCCCTTTGGCTTCCTCCTGTTTCTGGAGAAAGAGGATAGAAAGGACACCGC
TTCCCACCCCACCCCGGGTGGGTCTGTAGTGTCCGAGGCCACTGCACAAGTGTCCGTGCACACGAAGCAT
TTGCCAAAATGGTCTCTGTCTCTCCGGGAGACAAGAAAGGACAGGAGATAGGAAGGGAAGGCCCGTTACC
TGTGAACAAGGCTGTTCTTTGAGCACGAGACACTTTTCATTTGGGGCAGGGAAGTGAGCCAACACTCAGG
AGCCTCCCCAACAGCTGCCCTGCCTGCACCGCACAGAGTTGGAGGATCTGTCCCCCTCAGCTGCTCTGGG
GAGTGTTCAAGGGTGGAGAGAAGAAAAATGGGG
Notes:The probe template was PCR amplified from IMAGE:761063 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:761063 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9811 same embryo
 EMAGE:9813 same embryo
 EMAGE:9814 same embryo
 EurExpress:euxassay_000077 same experiment
 MGI:4824347 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS