Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:982

Pax6 paired box gene 6 ( MGI:97490)
TS12 (8.2 dpc)
in situ hybridisation

Data Images
EMAGE:982 EMAGE:982
Figure 5D of Oliver et al., 1995 [PMID:8575305] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 5A of Oliver et al., 1995 [PMID:8575305] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image A is a brightfield image of an adjacent section to image D. Image annotations: HF - headfold.
Expression Pattern Description
Spatial Annotation:
EMAGE:982EMAGE:982Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
982_voxel_strong_3D_1.wlz
982_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:982_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
neural ectoderm
detected detected
regionalExpression in anterior head fold; not as strong as Six3 in anterior head fold.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3764936
Entity Detected:Pax6, paired box gene 6 ( MGI:97490)
Sequence:sense strand is shown

>MGI:3764936
AATTCTGCAGACCCATGCAGATGCAAAAGTCCAGGTGCTGGACAATGAAAACGTATCCAACGGTTGTGTG
AGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGAGGGAGTAAGCCAA
GAGTGGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAACGGGAGTGCCCTTCCATCTTTGCTTG
GGAAATCCGAGACAGATTATTATCCGAGGGGGTCTGTACCAACGATAACATACCCAGTGTGTCATCAATA
AACAGAGTTCTTCGCAACCTGG
nt 294 - nt 595 of X63963.1
Notes:The Pax6 probe used in this study by Oliver et al., 1995 [PMID:8575305] is indicated as that used by Walther & Gruss, 1991 [PMID:1687460] ie: "an EcoRI-NheI-cDNA-fragment encoding most of the 3' part of the Pax-6 paired box." Editors Note: Restriction analysis of the sequence from Walther & Gruss (X63963.1) indicates it is likely to be the EcoRI-NheI fragment extending between nt294 and nt595 as the paired box domain extends between nt172 and nt597.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:8.2 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Oliver et al., 1995 [PMID:8575305] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8575305] Oliver G, Mailhos A, Wehr R, Copeland NG, Jenkins NA, Gruss P 1995 Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development (121):4045-55
 [ PMID:1687460] Walther C, Gruss P 1991 Pax-6, a murine paired box gene, is expressed in the developing CNS. Development (113):1435-49
Links:MGI:2148960 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI