Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9866

Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) ( MGI:97357)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866
"Pseudo-wholemount" of euxassay_018746. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018746_01 euxassay_018746_02 euxassay_018746_03 euxassay_018746_04
EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866
euxassay_018746_05 euxassay_018746_06 euxassay_018746_07 euxassay_018746_08 euxassay_018746_09
EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866
euxassay_018746_10 euxassay_018746_11 euxassay_018746_12 euxassay_018746_13 euxassay_018746_14
EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866
euxassay_018746_15 euxassay_018746_16 euxassay_018746_17 euxassay_018746_18 euxassay_018746_19
EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866 EMAGE:9866
euxassay_018746_20 euxassay_018746_21 euxassay_018746_22 euxassay_018746_23 euxassay_018746_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9866Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9866_wholemount_strong.wlz
9866_wholemount_moderate.wlz
9866_wholemount_weak.wlz
9866_wholemount_possible.wlz
9866_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9866_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 04 08 09 23 24
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 09 10 11 13 14 17 18 21 22 23 weak expression: see section 04 08 12 19 20 24
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 17 18 19 20 21 22 23 24 weak expression: see section 15 16
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 12 13 18 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 23
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 14 weak expression: see section 05 06 07 08 09 12 15 17 18 19 20 21 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 15 weak expression: see section 09 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 weak expression: see section 12 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 weak expression: see section 04 05
stomach
moderate moderate
regionalmoderate expression: see section 03 05 06 07 weak expression: see section 01 02 04 08
hindgut
strong strong
regionalstrong expression: see section 17 moderate expression: see section 15 weak expression: see section 16
midgut
strong strong
regionalstrong expression: see section 09 10 17 moderate expression: see section 11 12 13 14 15 18 19 20 21 weak expression: see section 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 11 16 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 06 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 14 18 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 22 weak expression: see section 21
metanephros
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 21 moderate expression: see section 19 22 weak expression: see section 20
urethra of male
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 15 16
lung
strong strong
regionalstrong expression: see section 05 06 07 09 10 13 14 17 18 21 moderate expression: see section 02 03 04 08 11 12 15 19 20 22 23 weak expression: see section 01 16 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50722
Entity Detected:Mycn, v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) ( MGI:97357)
Sequence:sense strand is shown

>T50722
CTGCCATGACCTTGGAAAAAAAACTGACTTATGGGATGCTGGGTGGCTTGTTTTCCTCCTCCATATCACC
TGGTGACAGCCGTGGAAGTTCGGGACACTAAGGAGCTTCAGGAGGCTGTGAAGTCACCTTGTTCCAAGAT
TCCAAACAGAGTCATTCCTTCTTTTTACAATGGTGCTTAAGTTCCAGCAAATGCCACAGAAGGGGGGGGG
GTTGCCATTTGATGCCCCTGGGAACACTTGTGTAAATACCATTGATACACCCGCCTTTTGTATACGTCCT
GGGTAATGAGAGGTGGCTCTTGCGGCCAGTATTAGACTGGAAGTTCACACCTAAGTACTGTAAGAATACC
TCAATGTTTGAGGGGCATGTTTTGTATACAAATATATTGTTAATCTGTTATGTACTGTACTAATTCCTAC
ACGGCCTGTATACTTTAGTATGACGCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATG
AGTTGTGGAAGTTTTGAGTAGATATTACTTTATCACTTTTTGAACTAAGAAACTTTTGTAAAGAAATTTT
ACTATATATATATATTCCTTTTTTTCCTAGCCTGTTTCTTCCTTGTTTACTGTATTTGTTCATGTTTGGT
GCATAGAACTGGGTAAAATGGCAAAGTTCTGTGTTTAATTTCTTCAAAATGTATATATTTAGTGCTGCAC
CTTAGAGCA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CTGCCATGACCTTGGAAAAA; Reverse Primer - name:unspecified, sequence:TGCTCTAAGGTGCAGCACTAAA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9864 same embryo
 EMAGE:9865 same embryo
 EMAGE:9863 same embryo
 EurExpress:euxassay_018746 same experiment
 MGI:4826536 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS