Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9934

Grrp1 glycine/arginine rich protein 1 ( MGI:1919940)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934
"Pseudo-wholemount" of euxassay_008176. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008176_01 euxassay_008176_02 euxassay_008176_03 euxassay_008176_04
EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934
euxassay_008176_05 euxassay_008176_06 euxassay_008176_07 euxassay_008176_08 euxassay_008176_09
EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934
euxassay_008176_10 euxassay_008176_11 euxassay_008176_12 euxassay_008176_13 euxassay_008176_14
EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934
euxassay_008176_15 euxassay_008176_16 euxassay_008176_17 euxassay_008176_18 euxassay_008176_19
EMAGE:9934 EMAGE:9934 EMAGE:9934 EMAGE:9934
euxassay_008176_20 euxassay_008176_21 euxassay_008176_22 euxassay_008176_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9934Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9934_wholemount_strong.wlz
9934_wholemount_moderate.wlz
9934_wholemount_weak.wlz
9934_wholemount_possible.wlz
9934_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9934_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 21 22
upper leg muscle
strong strong
regionalstrong expression: see section 05 06 07
shoulder rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 02 05
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16
pancreas
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 13 15 16
thyroid gland
strong strong
regionalstrong expression: see section 13 moderate expression: see section 16
pituitary gland
strong strong
regionalstrong expression: see section 11 12 13 14 16 17 moderate expression: see section 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 11
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 moderate expression: see section 15 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 18 19 20 21 22 23 moderate expression: see section 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 10 11 12 13 17 18 weak expression: see section 15 16
rest of cerebellum ventricular layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 weak expression: see section 18 19 21 22 23
pons ventricular layer
strong strong
homogeneousstrong expression: see section 14 moderate expression: see section 08 09 10 11 12 13 weak expression: see section 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 weak expression: see section 15 16 17 18 19 20
ventral grey horn
weak weak
regionalweak expression: see section 13 14 16 17 18
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 04 weak expression: see section 23
naris
moderate moderate
regionalmoderate expression: see section 11 12 13 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 16 17 18
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 15
tongue muscle
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 11 14 15
mandible
strong strong
regionalstrong expression: see section 20 21 22 23 moderate expression: see section 04 05 06 07 08 17 18 19 weak expression: see section 09 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 20
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15
upper jaw molar
strong strong
regionalstrong expression: see section 20
testis
strong strong
regionalstrong expression: see section 07 08 09 moderate expression: see section 19 20 21
vault of skull
strong strong
regionalstrong expression: see section 01 02
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23
clavicle
strong strong
regionalstrong expression: see section 10 11 12 17
tail mesenchyme
strong strong
regionalstrong expression: see section 13 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T206
Entity Detected:Grrp1, glycine/arginine rich protein 1 ( MGI:1919940)
Sequence:sense strand is shown

>T206
AGCGCGCAGTGTGTCCCACGTGCTCGCTGCCACTGTCGGAGAAAGAGCGATTCTTCAACTACTGCGGCTT
GGAGCGCGCGCTGGTGGAGGTGCTGGGCGCCGAGCGCTTCTCTCCGCAGAGCTGGGGCGCAGAGCACGGC
CCTCAGGTCGCAACGTCGCCGCCGCCCGGCTCCGGGGACACCAGCGATTGGACATCCAGCGACAGGGACG
CGGGTAGCCCGGACTGTGCGGGCGGCGGCGGCGGCTCGGAGGCGGCAGGGTCGGCGCGGGACGGACGCCC
CACGGTGTCGGTGGTGGAACGCAACGCGCGCGTCATCCAGTGGTTGTACGGCTGCCAGCGCGCACGCGCC
CCGCCGCGCGAGTCTGAGGTGTGACCACCACCAGACGGGAAGACGGCTCCGGGAGAGCTAGCCCGGTCCG
TGAACAAATCCTTCCCTGGATCTCAGGTTCCCAGATCTGCACGCTGAGCAGGCAGGACCAC
Notes:The probe template was PCR amplified from IMAGE:2648627 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648627 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9936 same embryo
 EMAGE:9932 same embryo
 EMAGE:9933 same embryo
 EMAGE:9935 same embryo
 EurExpress:euxassay_008176 same experiment
 MGI:4825245 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS