Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9942

Paqr4 progestin and adipoQ receptor family member IV ( MGI:1923748)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942
"Pseudo-wholemount" of euxassay_000093. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000093_01 euxassay_000093_02 euxassay_000093_03 euxassay_000093_04
EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942
euxassay_000093_05 euxassay_000093_06 euxassay_000093_07 euxassay_000093_08 euxassay_000093_09
EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942
euxassay_000093_10 euxassay_000093_11 euxassay_000093_12 euxassay_000093_13 euxassay_000093_14
EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942
euxassay_000093_15 euxassay_000093_16 euxassay_000093_17 euxassay_000093_18 euxassay_000093_19
EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942 EMAGE:9942
euxassay_000093_20 euxassay_000093_21 euxassay_000093_22 euxassay_000093_23 euxassay_000093_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9942Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9942_wholemount_strong.wlz
9942_wholemount_moderate.wlz
9942_wholemount_weak.wlz
9942_wholemount_possible.wlz
9942_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9942_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07
arm
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 01
hindlimb
moderate moderate
regionalmoderate expression: see section 06 09
foot
moderate moderate
homogeneousmoderate expression: see section 08 09
leg
moderate moderate
regionalmoderate expression: see section 03 04 06 08 09
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 07 09 10 11 21 22 weak expression: see section 23
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 10 11 21 22
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 10 11 22 weak expression: see section 23
spinal component of peripheral nervous system
moderate moderate
homogeneousmoderate expression: see section 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 11 19 20 21 22 weak expression: see section 14 23
otic capsule
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 03
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 03
scapula
moderate moderate
regionalmoderate expression: see section 05 06
acetabular region
moderate moderate
regionalmoderate expression: see section 05
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T274
Entity Detected:Paqr4, progestin and adipoQ receptor family member IV ( MGI:1923748)
Sequence:sense strand is shown

>T274
GTTCCTGTCATTCCTGCAGTGAGGATGCAGAGGAGTGGGACCAGGCTTCTCTCAGAGCCAAGTGGACATT
GGTCCTGCTTGTATCATCTGGCCAGGAGACAGGAGGGGAACTGCTGCTTTTCCTAGGCAACAGGCACAGC
TGTGGAATGGAGGTGTTGGATTCGGGCTTCACTGGACCAAGGACTCAGCTCTTCAGTGCCATGGTCTGAC
TGACCTGCCTACCAGAGACTTGTCTGCTCAGGAAATCTCTATACAGTGGGTGGCTCCAGCCTGCTGGCCC
AAGGGTACTGACTCGCAGCCAGATCATCCCAAAGGCCCAAGACCCTAGGCAACATCAATAAAGGGACAAG
AAGAGCTATGCTGCCACATGAGCAACCTTGGGTGTTCCCAAGACGCATTACTTTTTATTAGACACGGAAG
TTTCAGGGGAGAGGTGGGCAAGACGGTCAGAGGTTTAAAAGCACCAAGGCTGGCTGGGCCTGT
Notes:The probe template was PCR amplified from IMAGE:2655231 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655231 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9941 same embryo
 EMAGE:9943 same embryo
 EurExpress:euxassay_000093 same experiment
 MGI:4827045 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS