Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9953

Lpar2 lysophosphatidic acid receptor 2 ( MGI:1858422)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953
"Pseudo-wholemount" of euxassay_000079. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000079_01 euxassay_000079_02 euxassay_000079_03 euxassay_000079_04
EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953
euxassay_000079_05 euxassay_000079_06 euxassay_000079_07 euxassay_000079_08 euxassay_000079_09
EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953
euxassay_000079_10 euxassay_000079_11 euxassay_000079_12 euxassay_000079_13 euxassay_000079_14
EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953
euxassay_000079_15 euxassay_000079_16 euxassay_000079_17 euxassay_000079_18 euxassay_000079_19
EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953 EMAGE:9953
euxassay_000079_20 euxassay_000079_21 euxassay_000079_22 euxassay_000079_23 euxassay_000079_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9953Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9953_wholemount_strong.wlz
9953_wholemount_moderate.wlz
9953_wholemount_weak.wlz
9953_wholemount_possible.wlz
9953_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9953_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
strong strong
regionalstrong expression: see section 02
oral region
moderate moderate
regionalmoderate expression: see section 07
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09
brain
moderate moderate
regionalmoderate expression: see section 01
physiological umbilical hernia
moderate moderate
homogeneousmoderate expression: see section 10 11 13
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 moderate expression: see section 01 07
telencephalon
moderate moderate
regionalmoderate expression: see section 10
cerebral cortex
strong strong
regionalstrong expression: see section 08 moderate expression: see section 09 15
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 09 14
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 01 09 14 15
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 02 04 05 06 07 08 moderate expression: see section 01 14
metencephalon alar plate
strong strong
regionalstrong expression: see section 07
cerebellum
strong strong
regionalstrong expression: see section 03 04 05 06 07
metencephalon rest of alar plate
strong strong
regionalstrong expression: see section 03 04 05
midbrain
strong strong
regionalstrong expression: see section 06 12 moderate expression: see section 10 13 14 15
midbrain lateral wall
strong strong
regionalstrong expression: see section 07 12 moderate expression: see section 13 15
midbrain mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 14
midbrain marginal layer
strong strong
regionalstrong expression: see section 08 12 moderate expression: see section 13 14 15
midbrain roof plate
strong strong
regionalstrong expression: see section 07
facial vii ganglion
strong strong
regionalstrong expression: see section 07
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 05 06 07 08 moderate expression: see section 01
vagus x ganglion
strong strong
regionalstrong expression: see section 05 06 07 08
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07
glossopharyngeal ix nerve
strong strong
regionalstrong expression: see section 05
spinal cord
moderate moderate
homogeneousmoderate expression: see section 13 weak expression: see section 15
spinal ganglion
strong strong
homogeneousstrong expression: see section 07
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 07 08 09 10 moderate expression: see section 11
lower jaw incisor
weak weak
regionalweak expression: see section 15
upper jaw incisor
weak weak
regionalweak expression: see section 15
metanephros
weak weak
homogeneousweak expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1491
Entity Detected:Lpar2, lysophosphatidic acid receptor 2 ( MGI:1858422)
Sequence:sense strand is shown

>T1491
TTTTTTTTTTTTTTAAGAAACAGATGCTTTAATGCCTTAAGAATTTGGCCTCAGATAAGACAGAGGTTCA
AGTTCCTGCTGTTCCTCGGCTGTGAATCTGAGGTGAGAACATAACCCCGACTCCTCTCTGGTGAGGCGGA
GCAGGGAGCCAAGTTCATGGCTCACACTGCCTGCTAGGAGGCTTCTCTGGCGAGAGAGGGAGGGAGGGAG
GGAGGGAAGGGAGGGAGTTAACCTCAGGCCTGGCATATCTGAGGTCTTGGGGGACTCAGAAGTAGAAAGT
CCAAGGGACACTGAAGCCCTTCCTCATGGAGTTTTCTGGTGCCCCCTGCATAGCTGTGCTTTTCCAAGCT
GTGCAGTCAGACACAGGCTCAATATGGCTTGTCATTCCTAGCACTCAGGGAGCCCAGGCAGGAAGAGACC
TGAGAGTTTGACATTAGCCTGAGCGGCACAGTGAGCTCTAGGGTGGACTGGGCTGCACTGTGAGACTTTG
GGTCTAAAA
Notes:The probe template was PCR amplified from IMAGE:537445 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:537445 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9955 same embryo
 EMAGE:9954 same embryo
 EurExpress:euxassay_000079 same experiment
 MGI:4825965 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS