Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9954

Sall1 sal-like 1 (Drosophila) ( MGI:1889585)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954
"Pseudo-wholemount" of euxassay_000198. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000198_01 euxassay_000198_02 euxassay_000198_03 euxassay_000198_04
EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954
euxassay_000198_05 euxassay_000198_06 euxassay_000198_07 euxassay_000198_08 euxassay_000198_09
EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954
euxassay_000198_10 euxassay_000198_11 euxassay_000198_12 euxassay_000198_13 euxassay_000198_14
EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954
euxassay_000198_15 euxassay_000198_16 euxassay_000198_17 euxassay_000198_18 euxassay_000198_19
EMAGE:9954 EMAGE:9954 EMAGE:9954 EMAGE:9954
euxassay_000198_20 euxassay_000198_21 euxassay_000198_22 euxassay_000198_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9954Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9954_wholemount_strong.wlz
9954_wholemount_moderate.wlz
9954_wholemount_weak.wlz
9954_wholemount_possible.wlz
9954_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9954_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
strong strong
regionalstrong expression: see section 02
hindlimb digit 1 skin
strong strong
gradedstrong expression: see section 01 19 20 21
hindlimb digit 2 skin
strong strong
regionalstrong expression: see section 01
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 03 04
hindlimb digit 3 skin
strong strong
regionalstrong expression: see section 02 03 04
hip mesenchyme
strong strong
homogeneousstrong expression: see section 03 moderate expression: see section 02 04
head mesenchyme
strong strong
regionalstrong expression: see section 03
thyroid gland
strong strong
homogeneousstrong expression: see section 10 14 15
adenohypophysis pars tuberalis
moderate moderate
homogeneousmoderate expression: see section 10 11 12 weak expression: see section 13
thyroid gland isthmus
strong strong
homogeneousstrong expression: see section 11 12 13
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 12
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 09 10 12
diencephalon lateral wall marginal layer
strong strong
single cellstrong expression: see section 13
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11 12 13
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 13 moderate expression: see section 04 06 07 08 09 10 14 15 16 17 18 19 21 22 23
corpus striatum
moderate moderate
homogeneousmoderate expression: see section 04 06 07 16 17 18 weak expression: see section 08 14 15 19
olfactory cortex mantle layer
strong strong
single cellstrong expression: see section 07 08 09 13 14 16
olfactory cortex marginal layer
strong strong
single cellstrong expression: see section 07 08 09 13 14 16
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 16 weak expression: see section 07 08 09 14
medulla oblongata
moderate moderate
single cellmoderate expression: see section 08
medulla oblongata floor plate
moderate moderate
homogeneousmoderate expression: see section 11
medulla oblongata lateral wall
moderate moderate
single cellmoderate expression: see section 08 09 10 13 16 17
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 12 moderate expression: see section 11 14 15
medulla oblongata basal plate ventricular layer
weak weak
homogeneousweak expression: see section 12 15 16
metencephalon floor plate
moderate moderate
homogeneousmoderate expression: see section 11
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 07 09 14 15 16 moderate expression: see section 08
rest of cerebellum ventricular layer
weak weak
homogeneousweak expression: see section 09 14 15
metencephalon rest of alar plate mantle layer
strong strong
single cellstrong expression: see section 06 17 18 moderate expression: see section 04 08 09 10
metencephalon rest of alar plate marginal layer
moderate moderate
single cellmoderate expression: see section 07
pons mantle layer
strong strong
single cellstrong expression: see section 14 15 moderate expression: see section 13 16
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 15 16 17
midbrain marginal layer
strong strong
single cellstrong expression: see section 08
midbrain ventricular layer
weak weak
homogeneousweak expression: see section 08 09 15 16
basal columns
moderate moderate
single cellmoderate expression: see section 14
ventral grey horn
moderate moderate
single cellmoderate expression: see section 11 12 13 14 15 16
intermediate grey horn
moderate moderate
single cellmoderate expression: see section 14 15 16
spinal cord ventricular layer
moderate moderate
homogeneousmoderate expression: see section 12 13 14
labyrinth epithelium
strong strong
regionalstrong expression: see section 03 04 06 07 17 18 20 moderate expression: see section 19
nasal cavity olfactory epithelium
moderate moderate
homogeneousmoderate expression: see section 07 09 13
maturing glomerular tuft
strong strong
homogeneousstrong expression: see section 08 09 10 16 17 19 20
genital tubercle of male
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1490
Entity Detected:Sall1, sal-like 1 (Drosophila) ( MGI:1889585)
Sequence:sense strand is shown

>T1490
TTTTTTTTTTTTTTACATTTATATACAGACTTTATTAGAGATCTAACGTATCACGGAGGCATTGCATCAA
CACCAGATTCATATTAAACTGGATATAGAAAATAAGTTAATGCCGGATTAAGACCGCCTAGCAGGGCAAC
TTGCGATTGCCATAAATGTTACAGCAAGCTAGGAGCACTCTAGTCCATTAGTATTTAGTCCAAAATACAG
AAGACCAAAGTTAATGCCTGCACTCTGTTTGCAAAGCAAGGTTATAGCACTAATAAATAAGCTTTCTTAG
AACTCTAGAGGTTGAACAACATACAAAAGAATGTCTTCATAGTGTAGTTCATAGTCCCAGGGGCCAGAGG
GTAAAGGGCGGGGGGAGGGGCAGGAGGCAACCTCGGGCGACATTCTGAGAGGAAGCACTCTGGCAGCTTT
AGCTTGTGACGATCTCTTTGCTGTCCTCCACGAAGCGGGTGAAACGGAAGTTGGTTCCGTTCTCGCTGCT
CGCCATTTT
Notes:The probe template was PCR amplified from IMAGE:537158 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:537158 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9953 same embryo
 EMAGE:9955 same embryo
 EurExpress:euxassay_000198 same experiment
 MGI:4827858 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS