Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10059

Slc6a11 solute carrier family 6 (neurotransmitter transporter, GABA), member 11 ( MGI:95630)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059
"Pseudo-wholemount" of euxassay_019686. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019686_01 euxassay_019686_02 euxassay_019686_03 euxassay_019686_04
EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059
euxassay_019686_05 euxassay_019686_06 euxassay_019686_07 euxassay_019686_08 euxassay_019686_09
EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059
euxassay_019686_10 euxassay_019686_11 euxassay_019686_12 euxassay_019686_13 euxassay_019686_14
EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059
euxassay_019686_15 euxassay_019686_16 euxassay_019686_17 euxassay_019686_18 euxassay_019686_19
EMAGE:10059 EMAGE:10059 EMAGE:10059 EMAGE:10059
euxassay_019686_20 euxassay_019686_21 euxassay_019686_22 euxassay_019686_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10059Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10059_wholemount_strong.wlz
10059_wholemount_moderate.wlz
10059_wholemount_weak.wlz
10059_wholemount_possible.wlz
10059_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10059_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 13
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 10 11 12 14 15 16 17
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 15 16 17
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 moderate expression: see section 01 02 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 15 17 18 19
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
pons mantle layer
strong strong
single cellstrong expression: see section 08 09 12 13 14 15 17 19
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 10 11 12 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 17
ventral grey horn
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 16
intermediate grey horn
strong strong
regionalstrong expression: see section 14
heart ventricle
strong strong
spottedstrong expression: see section 09 10 11 12 13 14 15 18 moderate expression: see section 16 17
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 15 17 18 19 20 21 22 23 weak expression: see section 13 14 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T56006
Entity Detected:Slc6a11, solute carrier family 6 (neurotransmitter transporter, GABA), member 11 ( MGI:95630)
Sequence:sense strand is shown

>T56006
GTCACCTGGGTCTGAGAAGCCTTCACTTCCACTTGCCAGAGGGAAGAACTGGCCACCCATCTGTCAGGCT
CTTCCTTGGAAACGAAGAGCAGAGGTGGTCTCTAGGGGGAGGCTGGTGCCATTCCCTCCTGCCTGGCTCA
GACCTCTTAGACTGGTCTCTCTTCCTCAGCTGGTGGGTTCTTTGTCTGCCCAGCTATTGGAGGATGGGAA
GTGGAGGGAGGGTCACTCTTTCCCTCTTACTGTAGTTTCCTAGATTTATCTGAGGAAAAGTGAGATGTCT
TCACGCTAAGGCTCCAGTGTTCTGGTCAGAGACCTGAATGCTCTATTTGCCCAATGCTTCCAGACTCTTA
GCTGTTCTGCCCAGCCCCCGTCCCGCTCCCACGTAAAGCCTGAGTTGGCTGAGCCAAATGCCCAGCACTG
CCCCCACCTAACTGGGCACTTGTGTAGGGCACACCACCCCCAGCTGCTCACACACAGACCACATATTCCT
TCTGGGAAGGGCCAGCATCATCCTGAAGATGACCTGTGGGGTTGGTCCTTGATGGCTGTCCCCTCCACCC
TACCCCTGAGAAGGGAAGCTGCCCGTTGCTGCTACTGCACCTCACCACCAACTCCCTCATGGACAGACAG
ATCCCTGATGTCTGTCACTATAGACACACGTGTTGTACATGTGGCCCTTAACACTTGACACTCTTAACAC
TACTCATGGGGCTGGGTAGAGGGAGGCTTGTGGTTTGGGGGGTTGTTATTTTTTGCTTTCTTTTCTTCCT
TTCTTTTTTCTTTTTGTCTTTTTTTGTAATTTCATACTAGTATTTGGGTAACTGTAGGGAGGAGGGGAGG
GTAAGTGGGGGCAAGTGGGGGCAAGGGGACATATCATTGTGACAACTTTTTTGATATTTACTAGAAATGA
TGCAATATATCCTTTCTGAGATATTTACAGTATTATTAAAGGGTTGGGCTGTTTTGCATA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GTCACCTGGGTCTGAGAAGC; Reverse Primer - name:unspecified, sequence:TATGCAAAACAGCCCAACCC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828259 same experiment
 EurExpress:euxassay_019686 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS