Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10310

Tenc1 tensin like C1 domain-containing phosphatase ( MGI:2387586)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310
"Pseudo-wholemount" of euxassay_000565. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000565_01 euxassay_000565_02 euxassay_000565_03 euxassay_000565_04
EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310
euxassay_000565_05 euxassay_000565_06 euxassay_000565_07 euxassay_000565_08 euxassay_000565_09
EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310
euxassay_000565_10 euxassay_000565_11 euxassay_000565_12 euxassay_000565_13 euxassay_000565_14
EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310 EMAGE:10310
euxassay_000565_15 euxassay_000565_16 euxassay_000565_17 euxassay_000565_18 euxassay_000565_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10310Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10310_wholemount_strong.wlz
10310_wholemount_moderate.wlz
10310_wholemount_weak.wlz
10310_wholemount_possible.wlz
10310_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10310_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 04 moderate expression: see section 05 06 07 17 weak expression: see section 18 19
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 02
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 03
otic capsule
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
meckel's cartilage
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
cranium
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 17 18 19
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T469
Entity Detected:Tenc1, tensin like C1 domain-containing phosphatase ( MGI:2387586)
Sequence:sense strand is shown

>T469
CTCGAGNCTGTTGGCCTACTGGTGACAGCCACAGAGGAAGGAGAGACAGGCCAGAAGAGCCATGAAGCCG
AGGAAAGCAGAACCACACAGCTTCCGGGAGAAGGTTTTCCGGAAGAAAACTCCAGTGTGTGCAGTGTGTA
AGGTGACCATCGATGGGACCGGTGTCTCCTGCCGAGTCTGCAAGGTGGCCACACACAGAAAATGTGAAGC
AAAGGTGACTTCATCCTGTCAGGCCTTGCCCCCTGCGGAGCTGCGGAGAAGCACAGCCCCGGTCCGGCGC
ATAGAACACCTGGGGTCCACCAAGTCTCTGAACCACTCAAAGCAACGCAGTACTCTACCCAGGAGCTTCA
GCCTAGATCCGCTCATGGAGCGTCGCTGGGACTTGGACCTCACCTATGTAACGGAGCGGATCTTGGCCGC
AGCTTTTCCTGCACGACCGGACGAGCAGCGACACCGAGGCCACTTGCGCGAGCTAGCCCATGTGCTTCAA
TCCAAGCACAGAGACAAGTACCTGCTCTTCAACCTTTCAGAGAAACGGCATG
Notes:The probe template was PCR amplified from IMAGE:1451210 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1451210 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10311 same embryo
 EMAGE:10309 same embryo
 EurExpress:euxassay_000565 same experiment
 MGI:4828660 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS