Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10546

Nav1 neuron navigator 1 ( MGI:2183683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546
"Pseudo-wholemount" of euxassay_000852. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000852_01 euxassay_000852_02 euxassay_000852_03 euxassay_000852_04
EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546
euxassay_000852_05 euxassay_000852_06 euxassay_000852_07 euxassay_000852_08 euxassay_000852_09
EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546
euxassay_000852_10 euxassay_000852_11 euxassay_000852_12 euxassay_000852_13 euxassay_000852_14
EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546 EMAGE:10546
euxassay_000852_15 euxassay_000852_16 euxassay_000852_17 euxassay_000852_18 euxassay_000852_19
EMAGE:10546 EMAGE:10546 EMAGE:10546
euxassay_000852_20 euxassay_000852_21 euxassay_000852_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10546Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10546_wholemount_strong.wlz
10546_wholemount_moderate.wlz
10546_wholemount_weak.wlz
10546_wholemount_possible.wlz
10546_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10546_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
moderate moderate
homogeneousmoderate expression: see section 02 not examined expression: see section 01 03 04 05 06
not examined not examined
homogeneousnot examined expression: see section 03 04 05 06
not examined not examined
homogeneousnot examined expression: see section 05
not examined not examined
homogeneousnot examined expression: see section 06
not examined not examined
homogeneousnot examined expression: see section 06
not examined not examined
homogeneousnot examined expression: see section 05 06
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 04 05 06 18 19
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 06 17
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 17
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 08 09 16 17 18 19 20 21
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 08 15 16
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 06 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
not examined not examined
regionalExpression in the turbinate bone.
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 08 09 15 16 17 18 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2366
Entity Detected:Nav1, neuron navigator 1 ( MGI:2183683)
Sequence:sense strand is shown

>T2366
TGGCCTCGAGCCAGAATTCGGATCCTTGGGTTCTGGACAGAAAGCTGCTTGGGAAGACCCGGTGGAATGG
GTCCGAGACACTCTTCCCTGGCCGTCGGCCCAACAAGACCAATCAAAGCTCTACCACCTGCCCCCGCCTT
CTGTGGGCCCCCACAGCACTGCCTCACCCCCGGAGGACAGGACAGTCAAAGACAGCACTCCAAACTCCCT
CGACTCAGATCCCCTGATGGCCATGCTGCTGAAACTCCAAGAAGCTGCCAACTACATTGAGTCACCAGAT
CGAGAGACTATCCTGGACCCCAACCTCCAGGCGACACTCTGAGGGCCCGGCAGAAGGCTGGCTTCAGCGT
CATTAGCTCTCCTCTGCCCTCTTCCTTCATAGCTCTGGCTCACCAGCCTCGCCAAGAGAACAGGAGGGAA
GAAGAGGGCAGGAGGAGGGATGGGTTCTCGGTGCTGAACCTTTGAGAACTTCCTACTAGGAATTGGAGGG
GGTGGAGTTTGAGAAATCCGTGTCCCTTAAATACATTTGCTGGC
Notes:The probe template was PCR amplified from IMAGE:1180081 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1180081 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10544 same embryo
 EMAGE:10543 same embryo
 EMAGE:10545 same embryo
 EMAGE:10542 same embryo
 EurExpress:euxassay_000852 same experiment
 MGI:4826604 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS