Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11642

Them4 thioesterase superfamily member 4 ( MGI:1923028)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642
"Pseudo-wholemount" of euxassay_008480. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008480_01 euxassay_008480_02 euxassay_008480_03 euxassay_008480_04
EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642
euxassay_008480_05 euxassay_008480_06 euxassay_008480_07 euxassay_008480_08 euxassay_008480_09
EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642
euxassay_008480_10 euxassay_008480_11 euxassay_008480_12 euxassay_008480_13 euxassay_008480_14
EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642
euxassay_008480_15 euxassay_008480_16 euxassay_008480_17 euxassay_008480_18 euxassay_008480_19
EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642 EMAGE:11642
euxassay_008480_20 euxassay_008480_21 euxassay_008480_22 euxassay_008480_23 euxassay_008480_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11642Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11642_wholemount_strong.wlz
11642_wholemount_moderate.wlz
11642_wholemount_weak.wlz
11642_wholemount_possible.wlz
11642_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11642_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 18 19
pons mantle layer
weak weak
regionalweak expression: see section 09 19
facial vii ganglion
weak weak
regionalweak expression: see section 06 07 08 09 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 09 21 22
trigeminal v ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 10
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 09 21 22
trigeminal v nerve
weak weak
regionalweak expression: see section 11 19
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 13 19
cervical ganglion
weak weak
regionalweak expression: see section 11 13 19
thoracic ganglion
weak weak
regionalweak expression: see section 14 15 17 18
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 14 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35642
Entity Detected:Them4, thioesterase superfamily member 4 ( MGI:1923028)
Sequence:sense strand is shown

>T35642
TAGTGTGGCTCTTTCTGGAACAGAGCAGAGAGCAGCGTCCTGCCCTCGGCTTGAGCAATGCTGAGAAACT
GCGCTATGCGCCTGCGCACTCTTGGGGCCACGCCTGCGAGGCGGCCAGGAGCAGCTAGGAGGTTATTTTC
TTCTGAGAAAGTCATTCGTAAGGACTATGCTCTCCCTAACCCCAGCTGGACTAAGGACCTCAGACTCCTT
TTTGATCAGTTCATGAAGAAATGTGAAGATGGCTCCTGGAAACGCATGCCTTCACACAGACAAAACCCTA
CTCGAGCTATTCAAGAGTTCCAAACCCTTTTTGTTGACTCGAAGTTTAAGAAAGAAGAACAAATGTCAAA
GGCCCAACAGTTCACCAGAAGTTTCGAGGAAGGGCTAGGCTTTGAGTATGCGATGTTCTATAATAAAGTT
GAGAAGAGGACGGTCTCCTTGTTTCAAGGAGGACTTCACCTGCAAGGAGTACCTGGATTTGTTCACGGAG
GTGCCATTGCAACCATCATTGATGTCACTACTGGCACGTGTGCAATTTCCGAAGGCGTTGCCATGACTGC
CAACCTCAACATCACCTATAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77722. Forward Primer - name:077722_F_cDNA_4921507I02Rik, sequence:TAGTGTGGCTCTTTCTGGAACA; Reverse Primer - name:077722_N_SP6_cDNA_4921507I02Rik, sequence:TTATAGGTGATGTTGAGGTTGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11644 same embryo
 EMAGE:11640 same embryo
 EMAGE:11643 same embryo
 EMAGE:11639 same embryo
 EMAGE:11641 same embryo
 EurExpress:euxassay_008480 same experiment
 MGI:4828697 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS