Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12616

Trank1 tetratricopeptide repeat and ankyrin repeat containing 1 ( MGI:1341834)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616
"Pseudo-wholemount" of euxassay_013745. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013745_01 euxassay_013745_02 euxassay_013745_03 euxassay_013745_04
EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616
euxassay_013745_05 euxassay_013745_06 euxassay_013745_07 euxassay_013745_08 euxassay_013745_09
EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616
euxassay_013745_10 euxassay_013745_11 euxassay_013745_12 euxassay_013745_13 euxassay_013745_14
EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616
euxassay_013745_15 euxassay_013745_16 euxassay_013745_17 euxassay_013745_18 euxassay_013745_19
EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616 EMAGE:12616
euxassay_013745_20 euxassay_013745_21 euxassay_013745_22 euxassay_013745_23 euxassay_013745_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12616Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12616_wholemount_strong.wlz
12616_wholemount_moderate.wlz
12616_wholemount_weak.wlz
12616_wholemount_possible.wlz
12616_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12616_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal cortex
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
seminiferous cord
strong strong
regionalstrong expression: see section 05 06 07 08 19 20 21 22
left lung
strong strong
regionalstrong expression: see section 05 06 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 15 16 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37825
Entity Detected:Trank1, tetratricopeptide repeat and ankyrin repeat containing 1 ( MGI:1341834)
Sequence:sense strand is shown

>T37825
TGCACTTCTGGGAGTTTCTGTACGGCAAGAAGGACCGGGAATCTGGGGAGGTGTTCTCCATCATCCAAGA
GTACAAGCCAAAGGATGTGACCAGAGCTATCCGGGACTTCCGGTTCCACCTGTCCTACCTTGTCAAGGTG
CTGTGTGGCTACGAGAATATGAACTTCAACGTCCTGCTTGACTCCTTCAGCGAAATAGACTATGTGATAT
CGGGGGAGGCAGAGCGGACACTGGTGCTGTGCTTGGTGATGCTGGTGAATGCTGAGGAAGTCCTGCAGCC
TTTCTGCAAGCCGCTTCTCTTCCGCCACTTCCGGGAGATCCAGACAAGGCTGCAGCTGATGAGCATGGAT
TGGCCGGGCCAGGTGCCCAAGAGGCTGCTGAAGGTGGTGCAGCGGGTGCTGGTGGCAGCCAGTGTGAAGT
CTGTGGCTGAGGCGCTGCAGGACCTGCTCTTCGAGCGAGACGAGGAGTACCTGGTGGATTGCCACTGGCG
GTGGGACAGTGTGCATACCAAAGGCACTGTGGTCCGTGGCCTCTGCCATGAGGAGGTCAGACTGAACCGC
CTGCTCTGTACGGGCCCCATGGACCAGTTTGCTGACTCAGAGTGGGATTTTGGTGAAGATGAGACTCATG
AATTAGATGAGTTGGCCCAGGAAGACCGAGATAATTTTCTGGCTGCCATCCTTTCCCAGAAGCAGCGAAA
GGCCTTGATCCAGCGCAAGCTGCGCAGAGTCTGCCTAGTGGTGTCTCTGTGCATCCGCTGGAGGAGGTGG
GTCCAGACAGAGCACAGCAGAGAGGATAGGGAGGTCAGACCTGGGAACTTCAAAAGGGCCGATGTAGACA
GGACCCAGTGCGACCTGTGTGGAGTAAAGTTTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82396. Forward Primer - name:082396_F_cDNA_LOC235639, sequence:TGCACTTCTGGGAGTTTCTGTA; Reverse Primer - name:082396_N_SP6_cDNA_LOC235639, sequence:TAAACTTTACTCCACACAGGTCG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12613 same embryo
 EMAGE:12614 same embryo
 EMAGE:12615 same embryo
 EurExpress:euxassay_013745 same experiment
 MGI:4828894 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS