Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15169

B4galt5 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 ( MGI:1927169)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169
"Pseudo-wholemount" of euxassay_010321. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010321_01 euxassay_010321_02 euxassay_010321_03 euxassay_010321_04
EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169
euxassay_010321_05 euxassay_010321_06 euxassay_010321_07 euxassay_010321_08 euxassay_010321_09
EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169
euxassay_010321_10 euxassay_010321_11 euxassay_010321_12 euxassay_010321_13 euxassay_010321_14
EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169
euxassay_010321_15 euxassay_010321_16 euxassay_010321_17 euxassay_010321_18 euxassay_010321_19
EMAGE:15169 EMAGE:15169 EMAGE:15169 EMAGE:15169
euxassay_010321_20 euxassay_010321_21 euxassay_010321_22 euxassay_010321_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15169Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15169_wholemount_strong.wlz
15169_wholemount_moderate.wlz
15169_wholemount_weak.wlz
15169_wholemount_possible.wlz
15169_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15169_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 17 weak expression: see section 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 11 18 weak expression: see section 08
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 18
basal columns
moderate moderate
regionalmoderate expression: see section 09 11 12 13 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 16 17 18 19
heart valve
moderate moderate
regionalmoderate expression: see section 11 12 14
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 12
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 05 06
larynx
moderate moderate
regionalmoderate expression: see section 13 14
trachea epithelium
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37582
Entity Detected:B4galt5, UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 ( MGI:1927169)
Sequence:sense strand is shown

>T37582
GATTTCACCTACTTTGCCAACCACCCTTGCCCAGAGAGGCTCCCTTCCATGAAGGGCCCGATAGATATAA
ACATGAGTGAGATCGCAATGGACGATATTCATGAGCTGTTCTCCAGAGACCCGGCCATTAAGCTCGGAGG
GCACTGGAAGCCTGCAGACTGTGTGCCTCGGTGGAAGGTGGCTATCCTCATCCCCTTCCGGAACCGCCAT
GAGCACCTCCCGGTCCTCCTGAGACACCTGCTCCCCATGCTTCAGCGCCAGGCCCTGCAGTTCGCCTTCT
ATGTGATCGAGCAAGTTGGCACCCAGCCCTTTAACCGAGCCATGCTTTTCAATGTTGGTTTTCAAGAAGC
CATGAAGGACTTGGATTGGGATTGTCTGATCTTCCATGACGTCGATCACATACCTGAGAGTGACCGAAAC
TACTATGGCTGCGGGCAGATGCCCAGGCACTTTGCAACCAAGCTGGACAAGTACATGTACCTGCTGCCCT
ACACTGAGTTTTTTGGTGGCGTGAGCGGCCTGACTGTAGAACAGTTTCGGAAAATCAATGGCTTTCCTAA
TGCCTTCTGGGGCTGGGGCGGAGAAGATGACGACTTGTGGAACAGGGTACAAAATGCAGGCTATTCTGTG
AGCCGGCCAGAAGGGGACACAGGAAAATACAAGTCCATTCCTCACCACCATCGAGGAGAGGTCCAGTTTC
TTGGCAGGTACGCTCTGCTGAGGAAGTCAAAGGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100469. Forward Primer - name:100469_F_cDNA_B4galt5, sequence:GATTTCACCTACTTTGCCAACC; Reverse Primer - name:100469_N_SP6_cDNA_B4galt5, sequence:GCTCCTTTGACTTCCTCAGCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15172 same embryo
 EMAGE:15168 same embryo
 EMAGE:15171 same embryo
 EMAGE:15170 same embryo
 EurExpress:euxassay_010321 same experiment
 MGI:4823380 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS