Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18008

F630043A04Rik RIKEN cDNA F630043A04 gene ( MGI:3041235)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008
"Pseudo-wholemount" of euxassay_011780. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011780_01 euxassay_011780_02 euxassay_011780_03 euxassay_011780_04
EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008
euxassay_011780_05 euxassay_011780_06 euxassay_011780_07 euxassay_011780_08 euxassay_011780_09
EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008
euxassay_011780_10 euxassay_011780_11 euxassay_011780_12 euxassay_011780_13 euxassay_011780_14
EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008
euxassay_011780_15 euxassay_011780_16 euxassay_011780_17 euxassay_011780_18 euxassay_011780_19
EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008 EMAGE:18008
euxassay_011780_20 euxassay_011780_21 euxassay_011780_22 euxassay_011780_23 euxassay_011780_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18008Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18008_wholemount_strong.wlz
18008_wholemount_moderate.wlz
18008_wholemount_weak.wlz
18008_wholemount_possible.wlz
18008_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18008_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 03 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 05
brain
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23
choroid invagination
moderate moderate
spottedmoderate expression: see section 06 07 08 09 16
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 02 13 14
heart ventricle
moderate moderate
spottedmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 17
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
right lung
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37707
Entity Detected:F630043A04Rik, RIKEN cDNA F630043A04 gene ( MGI:3041235)
Sequence:sense strand is shown

>T37707
ACTTTGGACTTCAGCGGTACATAATTTCCCAAGTCCCAGCCAACCCTCCCCAGACAGCTGCCAGCCTCAA
AGAAGAACGTGTAGCTGAGACCCCTCCTGCCAAAGACCCCTCTGTTCAAGTGCTGAAGACCCCGCGGTGT
GCTCTAAGGATGGATGATTTTGAGTGTGAAACTCCTAAATTAGAACACTTTGGTATATCTGAACATACTA
TGTGTTTAAATGAAGATTACACAATGGGACTTAAAAATATGAAGAACATTAAAAGTTCCCTTTTGAGTGG
TGTCAGTGGAGAAGCCATAGGAACTGGGCCTGTGACCAGTGATAATTCTTTTGCCATTCCTGGTCCCATA
ATCCAGCAGATGGAAGAAAACGATGTGGAATACGTAAGTTCACCATTGCCACCTAAATTCTGCACTCCTG
GTTTGAAAATTCCTTCTACAATGGACAGAACAGATTTGGTATCTATAGATTATCCACTATCAAAGCCAAA
TAGTTCATCAACTGATTTGGAAATTAAAGATTGTGTTCCGTTAATTTTAAATTCAGATGAATGCTATCAG
AGTTTTGCAGAGCCCCCTTCTTCAGCAATTACTTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 72557. Forward Primer - name:072557_F_cDNA_F630043A04Rik, sequence:ACTTTGGACTTCAGCGGTACAT; Reverse Primer - name:072557_N_SP6_cDNA_F630043A04Rik, sequence:AGAAGTAATTGCTGAAGAAGGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18010 same embryo
 EMAGE:18009 same embryo
 EMAGE:18011 same embryo
 EMAGE:18007 same embryo
 EurExpress:euxassay_011780 same experiment
 MGI:4824667 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS