Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18070

C230030N03Rik RIKEN cDNA C230030N03 gene ( MGI:3045297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070
"Pseudo-wholemount" of euxassay_011915. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011915_01 euxassay_011915_02 euxassay_011915_03 euxassay_011915_04
EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070
euxassay_011915_05 euxassay_011915_06 euxassay_011915_07 euxassay_011915_08 euxassay_011915_09
EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070
euxassay_011915_10 euxassay_011915_11 euxassay_011915_12 euxassay_011915_13 euxassay_011915_14
EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070
euxassay_011915_15 euxassay_011915_16 euxassay_011915_17 euxassay_011915_18 euxassay_011915_19
EMAGE:18070 EMAGE:18070 EMAGE:18070 EMAGE:18070
euxassay_011915_20 euxassay_011915_21 euxassay_011915_22 euxassay_011915_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18070Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18070_wholemount_strong.wlz
18070_wholemount_moderate.wlz
18070_wholemount_weak.wlz
18070_wholemount_possible.wlz
18070_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18070_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36082
Entity Detected:C230030N03Rik, RIKEN cDNA C230030N03 gene ( MGI:3045297)
Sequence:sense strand is shown

>T36082
CCAGCTGTCTCGTTTACTTCCTACTTCTCAAAGCAGGGCCCCTCCTTTGCAGGGTGAGTGCAAGCTGAGT
GATTGTAGCTTTAAGAGGGCATCTCCAGACACACCCTGTGTAGGCCTTCCACTGGAAAACCAGGTAGAAC
AGGCTTCTAGGTCATGCCCAGCCCCTTCCCACCTTACTTCAGAATTGCTGAAGCTCAACAGCCAAGAGGA
AGTGCCCAGGCCGGCTGAATGCAAGCCAGGGCACAGCCCAGAAAGCAGACTTGAGGAGCCCAAAGGTGTC
CACCCTGATGATGTTATCAGTAAACAACAGTGCCTGCTAAACATCTCCGGAGAGGCAGGAAGCCAGACGG
AGAACTACCCATCAATGAGTGCTCTCCAGGAGGAGAGAAAGCCGCCTGATAGGGCCTCCCTCTTCCCACA
ACACTGCTGCCATGGTGAGGTACCTGTGTGCAACAGAATGCTTGCAGGTTCCTGGGAAGAAGAGAGCGAT
AGCGCCTGTGCCCCAAGGACAGCCCTGAAATCAAGTGTCATTGGCTCTTTAGAAGCAGCAGAAGAGGGAG
TGGTTCTAGACCTCCAACGCAATGGGAAGGCCTTGCAAAGTCTTTTGGACTTCCCAACATTGGAAGTATC
TCACCGCAACCCTGGGAGTGAGTGTGCACAGGGACCTGGGGATGACCCGGAGCCTTCCCCTTCTGGCCAG
CGGCAGGCTCCAGGAGCCCACGGGGCCTCCAGGCACAGCTGCAAATTCATTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67627. Forward Primer - name:067627_F_cDNA_C230030N03Rik, sequence:CCAGCTGTCTCGTTTACTTCCT; Reverse Primer - name:067627_N_SP6_cDNA_C230030N03Rik, sequence:TAATGAATTTGCAGCTGTGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18068 same embryo
 EMAGE:18067 same embryo
 EMAGE:18071 same embryo
 EMAGE:18069 same embryo
 EMAGE:18072 same embryo
 EurExpress:euxassay_011915 same experiment
 MGI:4823547 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS