Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18239

Evx2 even skipped homeotic gene 2 homolog ( MGI:95462)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239
"Pseudo-wholemount" of euxassay_012021. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012021_01 euxassay_012021_02 euxassay_012021_03 euxassay_012021_04
EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239
euxassay_012021_05 euxassay_012021_06 euxassay_012021_07 euxassay_012021_08 euxassay_012021_09
EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239
euxassay_012021_10 euxassay_012021_11 euxassay_012021_12 euxassay_012021_13 euxassay_012021_14
EMAGE:18239 EMAGE:18239 EMAGE:18239 EMAGE:18239
euxassay_012021_15 euxassay_012021_16 euxassay_012021_17 euxassay_012021_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 weak expression: see section 10
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 13 weak expression: see section 14
pons mantle layer
weak weak
regionalweak expression: see section 05 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 15 weak expression: see section 06 07 08 09 10 11 12 13 14
facial vii ganglion
strong strong
regionalstrong expression: see section 02 weak expression: see section 03
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 04 05
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16
vagus x ganglion
weak weak
regionalweak expression: see section 06 14
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 04 05 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 06 08 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 06 11 weak expression: see section 04 08 09 10
dorsal root ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 09 10 11 12 13 14
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 weak expression: see section 08 09
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30684
Entity Detected:Evx2, even skipped homeotic gene 2 homolog ( MGI:95462)
Sequence:sense strand is shown

>T30684
TGGAAAGAGGGCTCCACAGCCCTACTGCTGGCAAGAGGTTCTCCAGTTTGTCCGATTCAGCTGGCGGTGC
TGTGCTCGAGGCCCTGGAAAATTCGCAGCACCCGGCTCGCCTCAGTCCGCGCCTGCCGTCCGCCCCGCTG
CACGGAGCTCTGGGAGACCTCCCCGCCAAAGGCAAATTCGAAATAGACACTTTGTTCAACCTGCAGCACC
CGAGCAGCGAAAGCACCGTCTCCTCCGAAATTGCCTCCGCTACCGAGAGCCGCAAGAAGCCTAGTCATTA
TTCCGAAGCGGCCGCCGAGGCCGACATGAGCAGCGACGTGGAGGTGGGCTGCTCCGCACTGCGCTCCCCC
AGCGGCCTGGGCGCTGCACCGCTCAAGGAAAACAATGCCAAAGGGTACACGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6827284), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59752. Forward Primer - name:059752_F_IRAV118_b02_Evx2, sequence:TGGAAAGAGGGCTCCACA; Reverse Primer - name:059752_R_SP6_IRAV118_b02_Evx2, sequence:CTCCGTGTACCCTTTGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18237 same embryo
 EMAGE:18236 same embryo
 EMAGE:18235 same embryo
 EMAGE:18238 same embryo
 EMAGE:18234 same embryo
 EurExpress:euxassay_012021 same experiment
 MGI:4824641 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS