Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18441

Rgs7 regulator of G protein signaling 7 ( MGI:1346089)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441
"Pseudo-wholemount" of euxassay_014400. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014400_01 euxassay_014400_02 euxassay_014400_03 euxassay_014400_04
EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441
euxassay_014400_05 euxassay_014400_06 euxassay_014400_07 euxassay_014400_08 euxassay_014400_09
EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441
euxassay_014400_10 euxassay_014400_11 euxassay_014400_12 euxassay_014400_13 euxassay_014400_14
EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441
euxassay_014400_15 euxassay_014400_16 euxassay_014400_17 euxassay_014400_18 euxassay_014400_19
EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441 EMAGE:18441
euxassay_014400_20 euxassay_014400_21 euxassay_014400_22 euxassay_014400_23 euxassay_014400_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18441Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18441_wholemount_strong.wlz
18441_wholemount_moderate.wlz
18441_wholemount_weak.wlz
18441_wholemount_possible.wlz
18441_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18441_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
humerus
weak weak
regionalweak expression: see section 01 02 03 04
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 22 23
femur
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 21 22
diencephalon
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 weak expression: see section 07 08 09 10 11 12
telencephalon
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04 05 07 08 09 10 11 12
hindbrain
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 weak expression: see section 05 07 08 09 10 11 12
midbrain
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 weak expression: see section 05 07 08 09 10 11 12
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 09 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 07 08 09 10 11 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 10 11 19 20
spinal cord
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 weak expression: see section 10 11 12
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 13 20
thoracic ganglion
weak weak
regionalweak expression: see section 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 19 20 21
neural retina
weak weak
regionalweak expression: see section 03 04 05 24
meckel's cartilage
weak weak
regionalweak expression: see section 06 07 08 09 10 11 13 14 15 16 18 19 20 21 22
temporal bone
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 08 22 23 24
vault of skull
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 06 07 08 20 21 22
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 04 05
pelvic girdle skeleton
weak weak
regionalweak expression: see section 08 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31841
Entity Detected:Rgs7, regulator of G protein signaling 7 ( MGI:1346089)
Sequence:sense strand is shown

>T31841
ATCCCGGATGAGAAACCCACACAAAACACGAAAGTCTGTCTATGGTTTACAAAATGACATCCGAAGTCAC
AGTCCCACCCACACACCTACACCAGAAACCAAGCCTCCTACAGAAGATGAGCTGCACCAACAGATAAAAT
ACTGGCAAATACAGTTAGATAGACATCGGTTAAAAATGTCAAAAGTTGCTGATAGTCTACTAAGCTATAC
GGAACAGTATGTAGAATATGACCCGTTTCTTGTGCCGCCTGACCCTTCCAATCCATGGCTCTCAGATGAT
ACGACTTTCTGGGAACTTGAAGCAAGCAAAGAACCAAGTCAACAGAGGGTAAAACGATGGGGTTTTGGTA
TGGATGAGGCATTGAAAGACCCAGTTGGGCGAGAGCAGTTCCTTAAGTTTCTAGAATCAGAATTCAGCTC
AGAGAACTTAAGGTTCTGGTTGGCAGTGGAGGACCTGAAGAGAAGGCCTATCCGAGAGGTCCCCTCGAGA
GTGCAGGAAATATGGCAAGAATTTCTGGCTCCTGGGGCCCCCAGTGCCATTAACTTGGATTCTAAGAGTT
ATGACAAGACCACACAGAATGTGAAGGAACCAGGACGATACACATTTGAAGATGCTCAGGAGCATATTTA
CAAGCTGATGAAGAGCGACTCATACCCCCGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6588901), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60977. Forward Primer - name:060977_F_IRAW1_g03_Rgs7, sequence:ATCCCGGATGAGAAACCC; Reverse Primer - name:060977_R_SP6_IRAW1_g03_Rgs7, sequence:AAGCGGGGGTATGAGTCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18444 same embryo
 EMAGE:18442 same embryo
 EMAGE:18443 same embryo
 EMAGE:18445 same embryo
 EurExpress:euxassay_014400 same experiment
 MGI:4827723 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS