Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18577

Unc13a unc-13 homolog A (C. elegans) ( MGI:3051532)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577
"Pseudo-wholemount" of euxassay_014553. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014553_01 euxassay_014553_02 euxassay_014553_03 euxassay_014553_04
EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577
euxassay_014553_05 euxassay_014553_06 euxassay_014553_07 euxassay_014553_08 euxassay_014553_09
EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577
euxassay_014553_10 euxassay_014553_11 euxassay_014553_12 euxassay_014553_13 euxassay_014553_14
EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577
euxassay_014553_15 euxassay_014553_16 euxassay_014553_17 euxassay_014553_18 euxassay_014553_19
EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577 EMAGE:18577
euxassay_014553_20 euxassay_014553_21 euxassay_014553_22 euxassay_014553_23 euxassay_014553_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18577Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18577_wholemount_strong.wlz
18577_wholemount_moderate.wlz
18577_wholemount_weak.wlz
18577_wholemount_possible.wlz
18577_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18577_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18 19
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38606
Entity Detected:Unc13a, unc-13 homolog A (C. elegans) ( MGI:3051532)
Sequence:sense strand is shown

>T38606
AGACAGGATCCAGTGACCCTTATGTCACCGTCCAGGTTGGGAAGACCAAGAAAAGGACAAAAACCATCTA
CGGGAACCTCAACCCAGTGTGGGAAGAGAATTTTCATTTTGAATGTCACAACTCCTCTGACCGGATCAAG
GTTCGTGTTTGGGATGAAGATGACGACATAAAATCCCGTGTGAAACAAAGGTTTAAGAGGGAGTCTGATG
ACTTCCTAGGGCAGACAATCATCGAGGTGCGGACGCTTAGCGGCGAGATGGATGTGTGGTACAATCTGGA
CAAGAGAACGGACAAGTCGGCGGTGTCGGGGGCCATCCGGCTTCACATCAGTGTGGAGATCAAAGGGGAG
GAGAAGGTGGCGCCCTACCATGTCCAGTACACCTGTCTGCATGAGAACCTGTTCCACTTTGTGACGGACG
TGCAGAACAATGGTGTGGTGAAGATTCCCGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149501. Forward Primer - name:149501_F_cDNA_Unc13a, sequence:AGACAGGATCCAGTGACCCTTA; Reverse Primer - name:149501_N_SP6_cDNA_Unc13a, sequence:CATCGGGAATCTTCACCACAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18579 same embryo
 EMAGE:18578 same embryo
 EMAGE:18580 same embryo
 EurExpress:euxassay_014553 same experiment
 MGI:4829096 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS