Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19931

Myo18a myosin XVIIIA ( MGI:2667185)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931
"Pseudo-wholemount" of euxassay_009374. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009374_01 euxassay_009374_02 euxassay_009374_03 euxassay_009374_04
EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931
euxassay_009374_05 euxassay_009374_06 euxassay_009374_07 euxassay_009374_08 euxassay_009374_09
EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931
euxassay_009374_10 euxassay_009374_11 euxassay_009374_12 euxassay_009374_13 euxassay_009374_14
EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931
euxassay_009374_15 euxassay_009374_16 euxassay_009374_17 euxassay_009374_18 euxassay_009374_19
EMAGE:19931 EMAGE:19931 EMAGE:19931 EMAGE:19931
euxassay_009374_20 euxassay_009374_21 euxassay_009374_22 euxassay_009374_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19931Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19931_wholemount_strong.wlz
19931_wholemount_moderate.wlz
19931_wholemount_weak.wlz
19931_wholemount_possible.wlz
19931_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19931_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21 22 23
upper leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 08 09 19 20 21 22 23 weak expression: see section 06 07
diaphragm
moderate moderate
regionalmoderate expression: see section 04 05 06 10 11 12 13 14 21 weak expression: see section 01 02 03 07 08 09 15 16 17 18 19 20 22 23
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 weak expression: see section 06
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 10 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 weak expression: see section 17
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36659
Entity Detected:Myo18a, myosin XVIIIA ( MGI:2667185)
Sequence:sense strand is shown

>T36659
ATGGAGAAGCTGACTGAGGAACGGGACCAGCGCGCCGCAGCTGAGAACCGTGAGAAGGAGCAGAACAAGA
GGCTCCAGCGACAGCTTCGTGACACCAAGGAGGAGATGAGCGAGCTTGCCAGGAAGGAAGCCGAGGCTAG
CCGCAAGAAGCATGAACTGGAGATGGACCTGGAGAGCCTGGAAGCTGCTAACCAAAGCCTGCAAGCCGAC
CTAAAGCTGGCGTTCAAACGCATTGGGGACTTGCAAGCTGCCATTGAGGATGAGATGGAAAGTGACGAGA
ACGAGGACCTCATCAACAGTGAGGGGGACTCAGATGTGGACTCAGAGCTGGAGGACCGGGTCGACGGGGT
CAAGTCCTGGTTGTCAAAGAACAAGGGACCTTCTAAGGCACCTTCTGACGATGGCAGCTTGAAGAGTTCC
AGCCCAACCAGCCACTGGAAGCCACTCGCCCCTGACCCATCGGATGATGAGCATGATCCTGTGGACAGCA
TCTCCAGACCCCGGTTCTCCCACAGCTATCTGAGTGACAGCGACACAGAGGCCAAGCTGACAGAGACCAG
TGCATAGCCTGGGATGGCTCACGACTCTTCCACCCCACAGCCTCTCCCAGGATAGAGGGGCACCACTGCC
CCCACCTGACTGCCGATCTGCATGGAAAACACCTTGGCTTTCTGTCAGGGGGACTTTCCAGGCTGTGGGC
CGTCTGACAGCTCCACGCGGCAGAGGTGGGCGAAGCAGAGTCTCTCCAAAGAGAGCTTCCGCTCTTGCCT
CTGAACGCCATGCTCTTAGCTCCCGCTCTGGGCCACTATGGACCACGTCAGGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90451. Forward Primer - name:090451_F_cDNA_Myo18a, sequence:ATGGAGAAGCTGACTGAGGAAC; Reverse Primer - name:090451_N_SP6_cDNA_Myo18a, sequence:CCACCTGACGTGGTCCATAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19932 same embryo
 EMAGE:19929 same embryo
 EMAGE:19930 same embryo
 EurExpress:euxassay_009374 same experiment
 MGI:4826558 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS