Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20201

Ppp1r9a protein phosphatase 1, regulatory (inhibitor) subunit 9A ( MGI:2442401)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201
"Pseudo-wholemount" of euxassay_012258. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012258_01 euxassay_012258_02 euxassay_012258_03 euxassay_012258_04
EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201
euxassay_012258_05 euxassay_012258_06 euxassay_012258_07 euxassay_012258_08 euxassay_012258_09
EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201
euxassay_012258_10 euxassay_012258_11 euxassay_012258_12 euxassay_012258_13 euxassay_012258_14
EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201 EMAGE:20201
euxassay_012258_15 euxassay_012258_16 euxassay_012258_17 euxassay_012258_18 euxassay_012258_19
EMAGE:20201 EMAGE:20201 EMAGE:20201
euxassay_012258_20 euxassay_012258_21 euxassay_012258_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20201Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20201_wholemount_strong.wlz
20201_wholemount_moderate.wlz
20201_wholemount_weak.wlz
20201_wholemount_possible.wlz
20201_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20201_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
single cellstrong expression: see section 01 02 03 04 05 21 22
upper leg muscle
strong strong
single cellstrong expression: see section 08 moderate expression: see section 07 09 15 16 weak expression: see section 17
hypothalamus mantle layer
moderate moderate
single cellmoderate expression: see section 11 12 weak expression: see section 15
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 09 16 17 18
pons mantle layer
moderate moderate
single cellmoderate expression: see section 10 16 17 18
pons ventricular layer
moderate moderate
single cellmoderate expression: see section 10 16 weak expression: see section 13 15
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 09 10 11 12 13 15 16 17 18 19
midbrain ventricular layer
moderate moderate
single cellmoderate expression: see section 10 11 12 16 weak expression: see section 17
tongue muscle
weak weak
regionalweak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30392
Entity Detected:Ppp1r9a, protein phosphatase 1, regulatory (inhibitor) subunit 9A ( MGI:2442401)
Sequence:sense strand is shown

>T30392
CCATGCTTGGATCAGCGTACATCTGGCAGTTACAAATCAAACTAATGTTCCTTACATCATTAGTTTATAG
TTTAGTCATTGTAATCTTTAAGTTAAATTATTGCAATCTTAAACCAAAATGAGTTCTTTTAACGTTGCTA
CTTAAAACTAGTAAAATCGTAAAGGGCTCTTGATTGCACTGTTCAGCAAAGGATAAGAGATGGACTGGTT
GGTCCGGTGTGGAAACAAAGTGAAGGACCTCAGATCTTGTGAGCGTTTTGACTTCTTGTTAGCTCCTTTA
TTGGCTGTAGTGCATGATAATAATTGAGTTTCCAACGTCTTGCACAATGCTTTCTTTAATGCTGTGGTTT
TCAGGGTTTATACAACTTAAAGAGAATTGTTGCTTCATGGACTTTAAGGATTTCGGACAGTTTTTAAGCT
ATCAACAAATGAACAGAAGGGGTTGTCTGCATATTGTGAACTGTACTCTAGTGAAGACTAGTGGGTCCCA
CCAGAAACCAAAAGTGTTTGGGGTACAATATATGTTCGGGTGTCAGGGTACATGGTGAGGCCCTGCCATA
GGTAGAGAGCATTGTAGGAGTAGATTCTGGGTCAGGGTTCCACTAAAGAACTGTGCACTGGATGTCTGTG
ATTAAGATCATCTCCTTTAAGGCAACTTATCCTTATGTGATCACGTCTTTCTCCTCCCCAGCATCAGGAG
GGTACTGTTAGAGCAGAAACCCTGCTCTATCTACTTTAGCACTCGATCGAAGCCTGCCATTACTATCGTG
ACAGCAAAGTCCCTCTGAAACCATCTGCCATCCTTCTGCTGGGGTTGGGATGGACTTCCTGCTCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6331919), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58625. Forward Primer - name:058625_F_IRAV102_h12_Ppp1r9a, sequence:CCATGCTTGGATCAGCGT; Reverse Primer - name:058625_R_SP6_IRAV102_h12_Ppp1r9a, sequence:GGGGAGCAGGAAGTCCAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20198 same embryo
 EMAGE:20200 same embryo
 EMAGE:20199 same embryo
 EMAGE:20197 same embryo
 EurExpress:euxassay_012258 same experiment
 MGI:4827380 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS