Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20204

Sh3pxd2a SH3 and PX domains 2A ( MGI:1298393)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204
"Pseudo-wholemount" of euxassay_012261. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012261_01 euxassay_012261_02 euxassay_012261_03 euxassay_012261_04
EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204
euxassay_012261_05 euxassay_012261_06 euxassay_012261_07 euxassay_012261_08 euxassay_012261_09
EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204
euxassay_012261_10 euxassay_012261_11 euxassay_012261_12 euxassay_012261_13 euxassay_012261_14
EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204 EMAGE:20204
euxassay_012261_15 euxassay_012261_16 euxassay_012261_17 euxassay_012261_18 euxassay_012261_19
EMAGE:20204
euxassay_012261_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20204Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20204_wholemount_strong.wlz
20204_wholemount_moderate.wlz
20204_wholemount_weak.wlz
20204_wholemount_possible.wlz
20204_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20204_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 17 18 19 20 weak expression: see section 05 06 07 08 09 10 11 12 14 15 16
diencephalon meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15
telencephalon meninges
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain meninges
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 09 10
clavicle
moderate moderate
regionalmoderate expression: see section 07 15 weak expression: see section 08 14 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37016
Entity Detected:Sh3pxd2a, SH3 and PX domains 2A ( MGI:1298393)
Sequence:sense strand is shown

>T37016
TCTCCTTCTCCTCCTCTGTCACCATCAGCACCACCTGTTCTTCCTCCTCCTCGTCGTCCTCCTTGTCCAA
GAACAATGGTGACCTGAAACCACGTTCTGCCTCAGATGCAGGTATCCGTGACACCCCTAAGGTTGGGACC
AAGAAAGATCCTGATGTGAAGGCCGGGCTGGCCTCCTGCGCCCGAGCCAAGCCATCCGTGAGACCAAAGC
CAGTCCTGAACCGAGCGGAGTCTCAAAGCCAGGAGAAGATGGATATTAGTTCCTTACGGCGCCAGCTGAG
GCCCACAGGCCAGCTCCGGGGGGGCCTCAAGGGCTCTAGGAGTGAGGACTCAGAGCTGCCTCCACAGATG
GCTTCTGAGGGATCCAGGCGAGGTTCTGCGGACATCATCCCTCTCACGGCCACCACTCCCCCGTGTGTCC
CCAAAAAGGAATGGGAAGGGCAAGGCGCCACCTACGTGACGTGCAGCGCCTATCAGAAGGTCCAGGACTC
GGAGATCAGCTTCCCCGAAGGCGCCGAGGTGCACGTGCTGGAGAAGGCGGTAAGTGGGTGGTGGTACGTG
AGGTTTGGGGAGCTGGAGGGCTGGGCTCCTTCCCACTACTTGGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97724. Forward Primer - name:097724_F_cDNA_Sh3md1, sequence:TCTCCTTCTCCTCCTCTGTCAC; Reverse Primer - name:097724_N_SP6_cDNA_Sh3md1, sequence:CCACCAAGTAGTGGGAAGGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20207 same embryo
 EMAGE:20206 same embryo
 EMAGE:20202 same embryo
 EMAGE:20203 same embryo
 EMAGE:20205 same embryo
 EurExpress:euxassay_012261 same experiment
 MGI:4828042 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS