Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20272

Epdr1 ependymin related protein 1 (zebrafish) ( MGI:2145369)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272
"Pseudo-wholemount" of euxassay_012376. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012376_01 euxassay_012376_02 euxassay_012376_03 euxassay_012376_04
EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272
euxassay_012376_05 euxassay_012376_06 euxassay_012376_07 euxassay_012376_08 euxassay_012376_09
EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272
euxassay_012376_10 euxassay_012376_11 euxassay_012376_12 euxassay_012376_13 euxassay_012376_14
EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272
euxassay_012376_15 euxassay_012376_16 euxassay_012376_17 euxassay_012376_18 euxassay_012376_19
EMAGE:20272 EMAGE:20272 EMAGE:20272 EMAGE:20272
euxassay_012376_20 euxassay_012376_21 euxassay_012376_22 euxassay_012376_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20272Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20272_wholemount_strong.wlz
20272_wholemount_moderate.wlz
20272_wholemount_weak.wlz
20272_wholemount_possible.wlz
20272_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20272_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 17
metencephalon rest of alar plate
moderate moderate
regionalmoderate expression: see section 16
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 06 07
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 18 19 20 21 22 weak expression: see section 05 06 07 08 09 10
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 08 09
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
mandible
strong strong
regionalstrong expression: see section 12 17 18 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 19 20 21 22 23
maxilla
strong strong
regionalstrong expression: see section 12 17 18 moderate expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31266
Entity Detected:Epdr1, ependymin related protein 1 (zebrafish) ( MGI:2145369)
Sequence:sense strand is shown

>T31266
TCCTCTGGACATTCCCCAGAATTCTACCTTTGAAGATCAGTACTCCATCGGAGGGCCTCAGGAGCAGATC
CTGGTCCAGGAGTGGTCTGACAGAAGAACAGCAAGATCCTATGAAACTTGGATCGGCGTTTATACAGCCA
AGGATTGTTATCCGGTCCAGGAGACCTTCATCAGGAACTACACTGTGGTCATGTCCACGCGGTTCTTTGA
TGTGCAGCTAGGCATTAAGGACCCCTCTGTGTTCACCCCACCAAGCACATGCCAGGCAGCGCAGCCAGAG
AAGATGAGTGACGGCTGCTCCTTGTGAACTCGCCGAACTGAACCCAACCTCAGCTCTTAGTGACCTTGTA
TGGCAATGGATTAGAGACTAGTTTGAAAGTAACTCTTCACTGAAAATAAAGCTAATTTTAGGAAGATAAA
CCCTATGTGGGCTTGCTTGTACATCTGACTGTGGCTGCTCAGCTCTGTTTTGAGAAGGAAAGGGGCCATC
CTTTCTGTGAGCAGGTGGGTAGTCAGTGCCATAGAGTAGGAAAGGGCGGGGGTGGGGTCAGCACAAGGAG
TTTGCCTCTGCAGGGTGAGACTTTTATTATTGCCAATAAGAATCGAAGGTGATAATAAGATATAGAATGC
TTTTGTTCAGTTCTCCCCTTACAAAGAAAGTCCCTTGCTTGTCTGCACCAGGGAAGCAAGAGCTCCCAGT
GACACCACCCCCTGCCTCTGGTTACTATAAGATGAGCCTTTAAGATTCTTTCTAGACTTAAATTTTGTGC
CATGGCCCACTGGATGTAGATATTCTACAAGGAAGTAGAAACTTTTAATACGAAGTAATGATTCCTCTAA
AGGGAAAGAAAGTTTTAAGAGGGAGGCTTGGACAATCTTAGTATTTACACGTGAGATGAAATGAAGAGTC
CCGTGTGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4223134), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55785. Forward Primer - name:055785_F_IRAV49_f07_AU040950, sequence:TCCTCTGGACATTCCCCA; Reverse Primer - name:055785_R_SP6_IRAV49_f07_AU040950, sequence:GCAGCACACGGGACTCTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20270 same embryo
 EMAGE:20275 same embryo
 EMAGE:20273 same embryo
 EMAGE:20271 same embryo
 EMAGE:20274 same embryo
 EurExpress:euxassay_012376 same experiment
 MGI:4824578 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS