Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20449

1700009P17Rik RIKEN cDNA 1700009P17 gene ( MGI:1922722)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449
"Pseudo-wholemount" of euxassay_012653. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012653_01 euxassay_012653_02 euxassay_012653_03 euxassay_012653_04
EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449
euxassay_012653_05 euxassay_012653_06 euxassay_012653_07 euxassay_012653_08 euxassay_012653_09
EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449
euxassay_012653_10 euxassay_012653_11 euxassay_012653_12 euxassay_012653_13 euxassay_012653_14
EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449
euxassay_012653_15 euxassay_012653_16 euxassay_012653_17 euxassay_012653_18 euxassay_012653_19
EMAGE:20449 EMAGE:20449 EMAGE:20449 EMAGE:20449
euxassay_012653_20 euxassay_012653_21 euxassay_012653_22 euxassay_012653_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20449Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20449_wholemount_strong.wlz
20449_wholemount_moderate.wlz
20449_wholemount_weak.wlz
20449_wholemount_possible.wlz
20449_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20449_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon floor plate
weak weak
regionalweak expression: see section 13
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata floor plate
weak weak
regionalweak expression: see section 12
metencephalon floor plate
weak weak
regionalweak expression: see section 12
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 moderate expression: see section 20
midbrain floor plate
weak weak
regionalweak expression: see section 12
spinal cord floor plate
weak weak
regionalweak expression: see section 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 13 16 17 18 19
heart ventricle
moderate moderate
spottedmoderate expression: see section 07 08 09 weak expression: see section 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31935
Entity Detected:1700009P17Rik, RIKEN cDNA 1700009P17 gene ( MGI:1922722)
Sequence:sense strand is shown

>T31935
CCAGGCCAACGAAAGAGAAAATCGCTGCCCATGAAGGTTACACTCAGATCATCGCCAACGATCGAGGGCA
TCTCTTGCCTTCAGTGCCCCGTTCCAAGGCAAGTCCTTGGGGTTCCTTCATGGGCACCTGGCAAATGCCC
CTGAAGATCCCACCTGCTAAGGTGACCTTGACCGCCCGTACAACTACAGCTGCCGACAACCTCACCAAAT
GGATACACAAGAATCCTGATCTACTCAACGCCTGTAATGGGCTGCGTCCTGAAATCTCAGGCAAGCCCTT
CGATCCTGACAGTCAGACGAAACAGAAGAAATCTGTCACCAAGACTGTACAACAAGCACCAAATCCAACC
ATAATTCCCAGCTCCCCGGTTATCCAAGGAGACAACCCAGATGAACCGCAAAGCTCGCACCCCTCTGCAG
GTCACACTCCAGGTCCCCAAACTCCAGTCAACTCTCCCAACAACCCACCTCCGAGCCCTTGTAAGAGCAC
CAAGTAGGTCCTAGTCTAGCTGAGGTCCAGATCTATGCCATGCTGGGGTGACATTTTAGAGACTGACCGA
AATAGGTGAGACCCTGCCTGTATTCAGAAATGTGGAACAGAGAAATGGTGGGCCAGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6774925), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61225. Forward Primer - name:061225_F_IRAW6_c11_1700009P17Rik, sequence:CCAGGCCAACGAAAGAGA; Reverse Primer - name:061225_R_SP6_IRAW6_c11_1700009P17Rik, sequence:ACTCCTGGCCCACCATTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20451 same embryo
 EMAGE:20450 same embryo
 EMAGE:20446 same embryo
 EMAGE:20448 same embryo
 EMAGE:20447 same embryo
 EurExpress:euxassay_012653 same experiment
 MGI:4822622 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS