Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20671

Lrpap1 low density lipoprotein receptor-related protein associated protein 1 ( MGI:96829)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671
"Pseudo-wholemount" of euxassay_013971. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013971_01 euxassay_013971_02 euxassay_013971_03 euxassay_013971_04
EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671
euxassay_013971_05 euxassay_013971_06 euxassay_013971_07 euxassay_013971_08 euxassay_013971_09
EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671
euxassay_013971_10 euxassay_013971_11 euxassay_013971_12 euxassay_013971_13 euxassay_013971_14
EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671
euxassay_013971_15 euxassay_013971_16 euxassay_013971_17 euxassay_013971_18 euxassay_013971_19
EMAGE:20671 EMAGE:20671 EMAGE:20671 EMAGE:20671
euxassay_013971_20 euxassay_013971_21 euxassay_013971_22 euxassay_013971_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20671Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20671_wholemount_strong.wlz
20671_wholemount_moderate.wlz
20671_wholemount_weak.wlz
20671_wholemount_possible.wlz
20671_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20671_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon roof plate
strong strong
regionalstrong expression: see section 11 12
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 10 13 14 15 16 17 18 19 20 21 22 23
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 08
choroid invagination
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15 16 17 18
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 12
metencephalon floor plate
strong strong
regionalstrong expression: see section 12
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09
kidney calyx
strong strong
regionalstrong expression: see section 05 06 07 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39411
Entity Detected:Lrpap1, low density lipoprotein receptor-related protein associated protein 1 ( MGI:96829)
Sequence:sense strand is shown

>T39411
ATAAGGATGGGGAGAAAGAAGCAAAACTGATCCACAACCTCAACGTCATCCTGGCCAGATACGGACTGGA
TGGGAGGAAGGACGCCCAGATGGTGCACAGCAACGCCCTCAATGAAGACACCCAGGATGAGCTGGGGGAC
CCCAGGCTGGAAAAGCTGTGGCACAAGGCAAAGACATCAGGGAAATTCTCCAGTGAAGAGCTGGGCAAGC
TGTGGAGAGAGTTTCTGCATTACAAAGAGAAGATCCAGGAGTACAATGTGCTGCTAGACACACTGAGCAG
AGCTGAAGAAGGTTATGAGAACCTTCTCAGTCCCTCGGACATGGCCCACATCAAGAGCGACACCCTGATC
AGCAAGCACAGTGAGCTGAAGGACAGACTGCGCAGTATCAACCAGGGCTTGGACCGCCTGCGGAAGGTCA
GCCACCAGGGCTATGGCTCCACCACTGAGTTTGAAGAGCCCCGGGTGATAGATCTGTGGGACCTGGCTCA
GTCTGCCAACTTCACTGAGAAGGAACTGGAGTCATTCAGGGAGGAGCTCAAGCACTTTGAGGCCAAAATT
GAAAAGCACAACCACTACCAGAAGCAGCTGGAGATTTCCCACCAGAAGCTGAAGCACGTGGAGAGCATCG
GCGACCCCGAGCACATCAGCCGCAACAAGGAGAAATACGTGCTGCTGGAGGAGAAGACCAAGGAGCTGGG
CTACAAGGTGAAGAAGCATCTACAGGACCTGTCTAGCAGGGTCTCAAGGGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90601. Forward Primer - name:090601_F_cDNA_Lrpap1, sequence:ATAAGGATGGGGAGAAAGAAGC; Reverse Primer - name:090601_N_SP6_cDNA_Lrpap1, sequence:AGCCCTTGAGACCCTGCTAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20669 same embryo
 EMAGE:20672 same embryo
 EMAGE:20673 same embryo
 EMAGE:20674 same embryo
 EMAGE:20670 same embryo
 EurExpress:euxassay_013971 same experiment
 MGI:4825986 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS