Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6342

Glis3 GLIS family zinc finger 3 ( MGI:2444289)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342
"Pseudo-wholemount" of euxassay_016279. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016279_01 euxassay_016279_02 euxassay_016279_03 euxassay_016279_04
EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342
euxassay_016279_05 euxassay_016279_06 euxassay_016279_07 euxassay_016279_08 euxassay_016279_09
EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342
euxassay_016279_10 euxassay_016279_11 euxassay_016279_12 euxassay_016279_13 euxassay_016279_14
EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342
euxassay_016279_15 euxassay_016279_16 euxassay_016279_17 euxassay_016279_18 euxassay_016279_19
EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342 EMAGE:6342
euxassay_016279_20 euxassay_016279_21 euxassay_016279_22 euxassay_016279_23 euxassay_016279_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6342Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6342_wholemount_strong.wlz
6342_wholemount_moderate.wlz
6342_wholemount_weak.wlz
6342_wholemount_possible.wlz
6342_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6342_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 02 03 15 17 18 19 20
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 08 09 10
medulla oblongata alar plate ventricular layer
weak weak
regionalweak expression: see section 08 09 15 16
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 12
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 04 05 17 18 20 21
pons ventricular layer
weak weak
regionalweak expression: see section 12 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 12 13
spinal cord roof plate
moderate moderate
regionalmoderate expression: see section 12
lower lip
weak weak
regionalweak expression: see section 05 06 07 09 14 15 16 17
upper lip
weak weak
regionalweak expression: see section 04 05 06 07 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45246
Entity Detected:Glis3, GLIS family zinc finger 3 ( MGI:2444289)
Sequence:sense strand is shown

>T45246
GGTCCGTTATTTTGCAAGAGTCTCTGGTGTCCACGACTTTGAGTCTGACAGAGAGTCAATCAGCCTTGAG
TGTGAAGCAAGAGTGGTCTCAGAGCTACAGGGCTTTCCCTTCACTTTCATCCAGCCACAGTTCCCAGAAT
GGCACGGACCTAGGGGACCTTCTTAGCTTGCCTCCAGGCACGCCAGTGTCTGGCAACAGCGTCTCCAACT
CGTTGCCACCCTACCTTTTCGGCATGGAAAATAGCCACTCTCCTTACCCTAGCCCTCGGCACTCAGCAAC
CAGGGCCCACTCCACCCGCTCTAAGAAGAGAGCATTGTCCTTGTCGCCACTGTCAGATGGCATCGGGATC
GACTTCAACACTATCATCCGTACTTCACCCACATCCTTGGTCGCCTACATCAACGGACCAAGAGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 194119. Forward Primer - name:194119_F_exon_Glis3, sequence:GGTCCGTTATTTTGCAAGAGTC; Reverse Primer - name:194119_N_SP6_exon_Glis3, sequence:GGCTCTTGGTCCGTTGATGTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6341 same embryo
 EurExpress:euxassay_016279 same experiment
 MGI:4825075 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS