Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6453

D10Bwg1379e DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed ( MGI:106387)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453
"Pseudo-wholemount" of euxassay_016265. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016265_01 euxassay_016265_02 euxassay_016265_03 euxassay_016265_04
EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453
euxassay_016265_05 euxassay_016265_06 euxassay_016265_07 euxassay_016265_08 euxassay_016265_09
EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453
euxassay_016265_10 euxassay_016265_11 euxassay_016265_12 euxassay_016265_13 euxassay_016265_14
EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453
euxassay_016265_15 euxassay_016265_16 euxassay_016265_17 euxassay_016265_18 euxassay_016265_19
EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453 EMAGE:6453
euxassay_016265_20 euxassay_016265_21 euxassay_016265_22 euxassay_016265_23 euxassay_016265_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6453Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6453_wholemount_strong.wlz
6453_wholemount_moderate.wlz
6453_wholemount_weak.wlz
6453_wholemount_possible.wlz
6453_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6453_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 12 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 13 14 15 16 17 moderate expression: see section 07 08 09 10 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 13 14 15 16
vomeronasal organ
weak weak
regionalweak expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45216
Entity Detected:D10Bwg1379e, DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed ( MGI:106387)
Sequence:sense strand is shown

>T45216
GTGCTATTCGAAGAGGAGGAGAGGAGCTCGGATTCCTCCCAACAGTGCTCGTCGGAGGATGAAGACATCT
TTGAGGAGACTGCGCAGGTGAGCCCCCCACGAGGCAAGGAGAAAAGGCAATGGCGGGCACGCCTGCCGTC
GCTCAGTGTGCAGCCAGTAAGCAATGCAGACTGGGTGTGGCTGGTCAAGAGGCTGCACAAGCTGTGCATG
GAGCTCTGTAACCACTACATCCAGATGCACCTGGACCTGGAGAGCAGCTTGGAGGAGCCACTTACCTTCA
AGAGCGACCCGTTCTTCATTCTCCCCTCCTTCCAGTCCGAATCGTCCACCCCATCAACAGGTGGCTTCTC
CGGGAAAAACACCCCCTCGGAAGATGACCGCAGGGAGCACCTGAGTGAGCCTCAGAGTCTGAGGGTCGGC
AGTGGGGACATGCTGATGCTGCCTCCCAGCCCCAAGACAGAGAAGAAGGATCCTGGCCGCAAGAAAGAGT
GGTGGGAGAGTGCAGGGAACAAGATTTGCACAATGGCCGCTGACAAGACCATCTCAAAGCTGATGACTGA
GTACAAGAAGAGAAGGCAGCCACATAACCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 204467. Forward Primer - name:204467_F_exon_D10Bwg1379e, sequence:GTGCTATTCGAAGAGGAGGAGA; Reverse Primer - name:204467_N_SP6_exon_D10Bwg1379e, sequence:CAGGTTATGTGGCTGCCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6456 same embryo
 EMAGE:6457 same embryo
 EMAGE:6455 same embryo
 EMAGE:6454 same embryo
 EurExpress:euxassay_016265 same experiment
 MGI:4824188 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS