Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6724

Ttc39c tetratricopeptide repeat domain 39C ( MGI:1919997)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724
"Pseudo-wholemount" of euxassay_007378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007378_01 euxassay_007378_02 euxassay_007378_03 euxassay_007378_04
EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724
euxassay_007378_05 euxassay_007378_06 euxassay_007378_07 euxassay_007378_08 euxassay_007378_09
EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724
euxassay_007378_10 euxassay_007378_11 euxassay_007378_12 euxassay_007378_13 euxassay_007378_14
EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724 EMAGE:6724
euxassay_007378_15 euxassay_007378_16 euxassay_007378_17 euxassay_007378_18 euxassay_007378_19
EMAGE:6724 EMAGE:6724 EMAGE:6724
euxassay_007378_20 euxassay_007378_21 euxassay_007378_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6724_wholemount_strong.wlz
6724_wholemount_moderate.wlz
6724_wholemount_weak.wlz
6724_wholemount_possible.wlz
6724_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6724_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
strong strong
regionalstrong expression: see section 05 06 07 14 15 16
brain
strong strong
regionalstrong expression: see section 09 moderate expression: see section 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 15 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07 14
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 14 15 16 17 18
anterior naris
strong strong
regionalstrong expression: see section 06 07 09 10
external naris
strong strong
regionalstrong expression: see section 06 10 11
seminiferous cord
moderate moderate
regionalmoderate expression: see section 05 06 07 15 16 17 18
clavicle
strong strong
regionalstrong expression: see section 09 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3307
Entity Detected:Ttc39c, tetratricopeptide repeat domain 39C ( MGI:1919997)
Sequence:sense strand is shown

>T3307
TGGCCTCGAGGCCAGATTCGGACGAGGCGGAAATCCCCCCCTCCATGGTCGATCGACTTCAGAGGCAGAT
CATCATCGCTGACTGCCAGGTTTACCTGGCAGTGCTTTCCTTTGTGAAACAAGAGTTGTCGGCCTACATA
AAAGGTGGGTGGATCCTTAGGAAAGCCTGGAAGATTTACAGTAAGTGCTATGTGGACATCAACGCCCTTC
AGGAACTGTATCAGAAGAAGCTGACGGAAGAGCCCTTGGCTTCTGATGCTGCAAATGATAACCACGTTGT
GGCCGAAGGGGTGACCGAGGAGTCCTTAAGCAGACTGAAAGGGGCTGTGAGCTTTGGATATGGCCTTTTC
CACCTTTGCATATCCATGGTGCCCCCAAACCTGCTCAAAATCATCAACCTGCTGGGCTTTCCTGGAGACC
GCCTACAGGGCCTTTCTTCACTGACGTATGCGAGCGAAAGTAAGGACATGAAGGCCCCTTTAGCTACATT
AGCCCTGCTGTGGTACCACACTGTGGTCCGCCCATTTTTTGCTTTGG
Notes:The probe template was PCR amplified from IMAGE:2780732 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2780732 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6722 same embryo
 EMAGE:6720 same embryo
 EMAGE:6721 same embryo
 EMAGE:6719 same embryo
 EMAGE:6723 same embryo
 EurExpress:euxassay_007378 same experiment
 MGI:4828990 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS