Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7262

Apc2 adenomatosis polyposis coli 2 ( MGI:1346052)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262
"Pseudo-wholemount" of euxassay_007719. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007719_01 euxassay_007719_02 euxassay_007719_03 euxassay_007719_04
EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262
euxassay_007719_05 euxassay_007719_06 euxassay_007719_07 euxassay_007719_08 euxassay_007719_09
EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262
euxassay_007719_10 euxassay_007719_11 euxassay_007719_12 euxassay_007719_13 euxassay_007719_14
EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262 EMAGE:7262
euxassay_007719_15 euxassay_007719_16 euxassay_007719_17 euxassay_007719_18 euxassay_007719_19
EMAGE:7262
euxassay_007719_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7262Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7262_wholemount_strong.wlz
7262_wholemount_moderate.wlz
7262_wholemount_weak.wlz
7262_wholemount_possible.wlz
7262_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7262_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 01 02 03 04 17 18
humerus
moderate moderate
regionalmoderate expression: see section 01 18 19 20
fibula
moderate moderate
regionalmoderate expression: see section 18 19
tibia
moderate moderate
regionalmoderate expression: see section 18 19
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 14 15 16 17 18
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 03 04 14
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 14 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 14 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 06 07 14
spinal cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 06 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 05 06 13 14
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 11 12 13
neural retina
moderate moderate
regionalmoderate expression: see section 01 20
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 13 14 15 16 17 18 weak expression: see section 01 02 07 08 09 11 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 weak expression: see section 06
scapula
moderate moderate
regionalmoderate expression: see section 01 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35940
Entity Detected:Apc2, adenomatosis polyposis coli 2 ( MGI:1346052)
Sequence:sense strand is shown

>T35940
CCTGGAAGCATCTTCTGAGTCTGACTCCCTCTTGTCTTTGGTGTCCGGGGTGTCAGCAGGCTCCACCCTC
CAGCCCTCCAAGCTCAGGAAAGGGCGAAAGCCTGCAGCAGAGGCTGGAGGTGCCTGGCGTCCTGAGAAAC
GGGGCACAACTTCCACTAAGATCAATGGGAGTCCCCGGCTACCTAACGGTCCTGAGAAGGCAAAGGGTAC
CCAGAAAATGATGGCAGGGGAGTCAACCATGCTCCGGGGACGGACAGTGATCTACTCAGCCGGCCCAGCC
TCCCGCACTCAGTCCAAAGGTATTTCTGGACCTTGTACCACACCTAAGAAGACAGGGACATCTGGTACCA
CTCAGCCAGAAACTGTCACCAAAGCCCCCAGCCCTGAGCAACAACGTTCACGGAGCCTCCACCGACCGGG
CAAGATCTCTGAGCTGGCAGCTTTGCGCCACCCGCCCAGGAGTGCCACTCCTCCAGCCCGCCTCGCCAAG
ACCCCGTCCTCAAGCTCTTCACAGACCTCTCCAGCATCCCAGCCCCTGCCTAGGCGGTCCCCTCTGGCCA
CTCCCACAGGAGGACCTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74587. Forward Primer - name:074587_F_cDNA_Apc2, sequence:CCTGGAAGCATCTTCTGAGTCT; Reverse Primer - name:074587_N_SP6_cDNA_Apc2, sequence:CAGAGGTCCTCCTGTGGGAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7260 same embryo
 EMAGE:7261 same embryo
 EurExpress:euxassay_007719 same experiment
 MGI:4823173 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS