Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7887

Cblb Casitas B-lineage lymphoma b ( MGI:2146430)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887
"Pseudo-wholemount" of euxassay_012817. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012817_01 euxassay_012817_02 euxassay_012817_03 euxassay_012817_04
EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887
euxassay_012817_05 euxassay_012817_06 euxassay_012817_07 euxassay_012817_08 euxassay_012817_09
EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887
euxassay_012817_10 euxassay_012817_11 euxassay_012817_12 euxassay_012817_13 euxassay_012817_14
EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887
euxassay_012817_15 euxassay_012817_16 euxassay_012817_17 euxassay_012817_18 euxassay_012817_19
EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887 EMAGE:7887
euxassay_012817_20 euxassay_012817_21 euxassay_012817_22 euxassay_012817_23 euxassay_012817_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7887Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7887_wholemount_strong.wlz
7887_wholemount_moderate.wlz
7887_wholemount_weak.wlz
7887_wholemount_possible.wlz
7887_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7887_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 11
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 11 14
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 03 04 05 06 21 22 moderate expression: see section 02 07 08 17 18 19 20 weak expression: see section 01 09 10 11 15 16 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 09
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 11 14 17 21 weak expression: see section 04 08 09 10 12 15 16 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 11 17 weak expression: see section 08 09 10 12 13 14 15 16 18
extrinsic ocular muscle
weak weak
regionalweak expression: see section 04 05 18 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 13 14
upper jaw incisor
weak weak
regionalweak expression: see section 09 10 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38193
Entity Detected:Cblb, Casitas B-lineage lymphoma b ( MGI:2146430)
Sequence:sense strand is shown

>T38193
GTGAACCTACACCTCACGATCATATAAAAGTTACACAGGAGCAGTATGAACTGTATTGTGAAATGGGCTC
CACTTTTCAGCTCTGCAAGATCTGTGCAGAGAATGACAAAGATGTCAAGATTGAGCCTTGCGGGCATCTG
ATGTGCACTTCGTGCCTTACCGCGTGGCAGGAGTCTGATGGCCAAGGCTGCCCCTTCTGTCGCTGTGAGA
TAAAAGGAACGGAGCCCATCATTGTGGACCCCTTCGACCCCAGAGATGAAGGCTCCAGGTGCTGCAGCAT
CATTGACCCTTTCAGCATCCCCATGCTTGACTTGGACGATGACGATGATCGAGAGGAGTCTTTGATGATG
AACAGGCTGGCGAGTGTTCGAAAGTGCACGGACAGGCAGAACTCACCAGTCACATCGCCAGGCTCCTCAC
CCCTTGCCCAGAGAAGAAAGCCTCAGCCAGACCCTCTCCAGATCCCCCACCTCAGCCTGCCACCAGTGCC
TCCCCGCCTAGATCTCATTCAGAAAGGCATCGTGCGCTCTCCGTGTGGCAGCCCCACAGGCTCGCCAAAG
TCTTCTCCATGCATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 104117. Forward Primer - name:104117_F_cDNA_Cblb, sequence:GTGAACCTACACCTCACGATCA; Reverse Primer - name:104117_N_SP6_cDNA_Cblb, sequence:CATGCATGGAGAAGACTTTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7883 same embryo
 EMAGE:7886 same embryo
 EMAGE:7884 same embryo
 EMAGE:7885 same embryo
 EMAGE:7882 same embryo
 EurExpress:euxassay_012817 same experiment
 MGI:4823651 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS