Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8329

Ntn4 netrin 4 ( MGI:1888978)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329
"Pseudo-wholemount" of euxassay_007631. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007631_01 euxassay_007631_02 euxassay_007631_03 euxassay_007631_04
EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329
euxassay_007631_05 euxassay_007631_06 euxassay_007631_07 euxassay_007631_08 euxassay_007631_09
EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329
euxassay_007631_10 euxassay_007631_11 euxassay_007631_12 euxassay_007631_13 euxassay_007631_14
EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329 EMAGE:8329
euxassay_007631_15 euxassay_007631_16 euxassay_007631_17 euxassay_007631_18 euxassay_007631_19
EMAGE:8329 EMAGE:8329 EMAGE:8329
euxassay_007631_20 euxassay_007631_21 euxassay_007631_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8329Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8329_wholemount_strong.wlz
8329_wholemount_moderate.wlz
8329_wholemount_weak.wlz
8329_wholemount_possible.wlz
8329_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8329_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 18 weak expression: see section 08 09
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 15 16 17 19 20 21 22 weak expression: see section 08 09
pons ventricular layer
strong strong
regionalstrong expression: see section 08 13 14 moderate expression: see section 07 09 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 14 15 17 18 weak expression: see section 11
heart valve
moderate moderate
regionalmoderate expression: see section 10 11 12 13 weak expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36708
Entity Detected:Ntn4, netrin 4 ( MGI:1888978)
Sequence:sense strand is shown

>T36708
GTACTTTGCAACAAACTGCTCGGCTACTTTTGGCCTGGAAGATGATGTTGTCAAGAAGGGAGCTATTTGC
ACGTCTAGATACTCAAATCCTTTCCCGTGCACCGGAGGAGAGGTTATTTTCAGAGCCCTGTCACCACCAT
ACGACATAGAAAACCCTTACAGTGCCAAAGTGCAGGAGCAGCTGAAGATCACCAACCTCCGAGTGCGGCT
GCTCAAGCGACAGTCCTGCCCTTGTCAGATAAACGACCTGAACGCAAAACCTCACCATTTTATGCACTAC
GCAGTCTATGACTTCATCGTCAAGGGCAGCTGCTTCTGCAACGGCCACGCTGACCAGTGCTTACCTGTGG
AGGGCTTCAGACCCATCAAGGCCCCGGGAGCGTTCCACGTGGTCCACGGGAGGTGTATGTGTAAGCACAA
CACAGCAGGCAGCCACTGCCAGCACTGTGCACCATTGTACAATGACCGGCCCTGGGAGGCAGCAGATGGC
AGAACAGGGGCTCCTAACGAATGCAGAACTTGCAAGTGCAATGGGCACGCGGACACCTGTCACTTCGACG
TCAACGTGTGGGAGGCGTCGGGGAACCGCAGCGGCGGTGTCTGCAACAACTGTCAGCACAACACTGAGGG
TCAGCACTGTCAGCGCTGTAAGCCCGGTTTCTACCGCGACCTCAGAAGACCCTTCTCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95924. Forward Primer - name:095924_F_cDNA_Ntn4, sequence:GTACTTTGCAACAAACTGCTCG; Reverse Primer - name:095924_N_SP6_cDNA_Ntn4, sequence:CGGAGAAGGGTCTTCTGAGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8330 same embryo
 EMAGE:8326 same embryo
 EMAGE:8325 same embryo
 EMAGE:8328 same embryo
 EMAGE:8327 same embryo
 EurExpress:euxassay_007631 same experiment
 MGI:4826818 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS