Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8421

Purg purine-rich element binding protein G ( MGI:1922279)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421
"Pseudo-wholemount" of euxassay_009631. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009631_01 euxassay_009631_02 euxassay_009631_03 euxassay_009631_04
EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421
euxassay_009631_05 euxassay_009631_06 euxassay_009631_07 euxassay_009631_08 euxassay_009631_09
EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421
euxassay_009631_10 euxassay_009631_11 euxassay_009631_12 euxassay_009631_13 euxassay_009631_14
EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421 EMAGE:8421
euxassay_009631_15 euxassay_009631_16 euxassay_009631_17 euxassay_009631_18 euxassay_009631_19
EMAGE:8421 EMAGE:8421 EMAGE:8421
euxassay_009631_20 euxassay_009631_21 euxassay_009631_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8421Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8421_wholemount_strong.wlz
8421_wholemount_moderate.wlz
8421_wholemount_weak.wlz
8421_wholemount_possible.wlz
8421_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8421_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
midbrain mantle layer
weak weak
regionalweak expression: see section 12 13
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 16 17 18 moderate expression: see section 05 06 weak expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36928
Entity Detected:Purg, purine-rich element binding protein G ( MGI:1922279)
Sequence:sense strand is shown

>T36928
GGACTGTCTAGGCGACTTCATCGAGCACTATGCCCATCTGGGCCTGAAAGGCCACAGACAGGAGCATGGC
CAGAGCAAAGAGCAAGTCTCCAGGAGGCGGCAGAAGCACTCTGCACCCTCCCCACCGGTGTCAGTGGGGT
CAGAAGAGCATCCTCACAGTGTCCTCAAAACGGACTATATAGAGAGGGACAATAGGAAATACTACCTGGA
CCTAAAGGAAAACCAACGAGGTCGCTTCCTAAGGATTAGACAAACCATGATGCGGGGCACTGGCATGATC
GGTTACTTTGGCCACAGTTTGGGCCAGGATCAGACTATTGTCCTCCCAGCACAAGGTATGATTGAATTTC
GTGATGCCTTGGTTCAGCTGATTGAAGACTACGGCGAAGGAGACATAGAAGAACGAAGGTGTGGAGACGA
CGACCCACTTGAACTCCCAGAGGGGACCTCTTTCAGAGTGGACAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66992. Forward Primer - name:066992_F_cDNA_Purg, sequence:GGACTGTCTAGGCGACTTCATC; Reverse Primer - name:066992_N_SP6_cDNA_Purg, sequence:ATTGTCCACTCTGAAAGAGGTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8422 same embryo
 EMAGE:8419 same embryo
 EMAGE:8418 same embryo
 EMAGE:8417 same embryo
 EMAGE:8420 same embryo
 EurExpress:euxassay_009631 same experiment
 MGI:4827537 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS