Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8653

Rprm reprimo, TP53 dependent G2 arrest mediator candidate ( MGI:1915124)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653
"Pseudo-wholemount" of euxassay_009961. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009961_01 euxassay_009961_02 euxassay_009961_03 euxassay_009961_04
EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653
euxassay_009961_05 euxassay_009961_06 euxassay_009961_07 euxassay_009961_08 euxassay_009961_09
EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653
euxassay_009961_10 euxassay_009961_11 euxassay_009961_12 euxassay_009961_13 euxassay_009961_14
EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653
euxassay_009961_15 euxassay_009961_16 euxassay_009961_17 euxassay_009961_18 euxassay_009961_19
EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653 EMAGE:8653
euxassay_009961_20 euxassay_009961_21 euxassay_009961_22 euxassay_009961_23 euxassay_009961_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8653Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8653_wholemount_strong.wlz
8653_wholemount_moderate.wlz
8653_wholemount_weak.wlz
8653_wholemount_possible.wlz
8653_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8653_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hand
strong strong
regionalstrong expression: see section 01 02 20 21 22 23 24
foot
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20 21
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 24 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 09 18 moderate expression: see section 10 11 12 13 14 15 16 17 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14 16 17 moderate expression: see section 12 13 15 18 19 20
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 07 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
strong strong
regionalstrong expression: see section 08 09 18 19 moderate expression: see section 07 10 11 12 13 14 15 16 17 20 21 22 23
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 08 18 19 20
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 15 16 17 18 19
neural retina
strong strong
regionalstrong expression: see section 01
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
vomeronasal organ
strong strong
regionalstrong expression: see section 08 11
metanephros
strong strong
regionalstrong expression: see section 07
renal cortex
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20 21
genital tubercle of male
strong strong
regionalstrong expression: see section 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31106
Entity Detected:Rprm, reprimo, TP53 dependent G2 arrest mediator candidate ( MGI:1915124)
Sequence:sense strand is shown

>T31106
ACCGGAGGCCGTCTAAAGAGGTGGAGGCAGTGGTCGTGGGACCCTACTGAGTGGCCCTCGGGTCCCCCTC
GGCGGGTGCCTCCCTTCTGGCACCTCCAGTACTCCGCCAGCCGCGATGCACCCCTCACCATCACGGACCG
AGCAACGCAAACCTGTCGGAGTCAGTTTTTTTCTCTTGACTTCTGCCTTTGGGGAAAAAGTGACCGATTT
CTGATAGCTCTTCGAAAGGCCCCAAGCAAGACTGTACAGGAGGAGCGCCCAGACTTCGGGACACAGCAGC
AGGTGGCAAAAGCAGGGCGCAGAACTTTGGGAGTGGCTGCTGGCGTGGGATACTGGGAGATGAACCAGGC
GGCGAAGGCCCCTTTCCACCTGCAGGTGGGCTCAGCACTGGGGACAGCTTGAGAGGCCGAGCAAGGCGGG
GTGTGGATGGGTGTGTATTCAGAGGCCCAGTGACCGGAAAAAGTGACTGTTTATTCGCCACGCTGCAGAC
CTAATTGGGAAGGAACATAGATGCGTGTGGGTTTTGCGACCTACTAAGAGAGTGAAACTTTGATCGATAG
TAACCTGTGGTTTTAGGGGATTTGTGTTAGTTTGCTTGAATACAAATATTTGATAAGTCTTTTGTGTCCT
AGTGGCCTGTTTGCCTGCCTGCGGGTTAGAGTTTTTTGTCATTCTGGGAGAACGGGTGGGGGGAGGGGAG
TCTGAGACTGTGAATGGGGTAAGTGCTTTCTTTTAGTGCATTTCCAGCTGGGTCTTTATGGGAGGCTAGC
GCTCCAGCTACGCCCGGGACAAAGATCCAGAGTAGAATTCTTAGCTCCTGTCTGCACGGTTTACGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1434823), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 56262. Forward Primer - name:056262_F_IRAV42_f01_Rprm, sequence:ACCGGAGGCCGTCTAAAG; Reverse Primer - name:056262_R_SP6_IRAV42_f01_Rprm, sequence:GGCGTAAACCGTGCAGAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8651 same embryo
 EMAGE:8649 same embryo
 EMAGE:8652 same embryo
 EMAGE:8648 same embryo
 EMAGE:8650 same embryo
 EurExpress:euxassay_009961 same experiment
 MGI:4827806 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS